Description :
From Genome Similarity Track
Location :
Scaffold_117:32630- 34138
Transcript NameFunction/comments
Sapdi_VS20SDRG_16181hypothetical protein
Sapdi_VS20SDRG_16182hypothetical protein

Sequence
1508 bases(100 bases per row)
CAAGGATGCTTGGATGCTTGGAGAGGACACGTTGGAGGGTTTCAATGACCTGGGATCGCTCGAGCACCACGCTTTTGAGGCGAAGGTTCTCGTGCATTGC
CCGTTGCACGCCGGTGGCTTGCTCGATGGCGCGGGCTTGCCACGGCAGCGCCGCGGCCGGGACATTGGCGAGCCGCGCCTGGAGCGTATGCAAGTGACGC
TGCAGCTTGGCGTGCGTTATGCGAAGGGCATCGATCTCTTGCTTGGGCCGCTGGTAGCCACGCTTGAGGCTGCTCGACGAGGCTGGTGACGACGCAGACG
ACGACGACGACGACGACGTTGTGTCGCCAAAGTCGACCGTTGGTGCGAGAAAAGCCGAGATGGTCGCAATGGAAATGTCGTCGGCCTTTTCGTTGGGCAA
GAGACTTATGCTGGTCATGCTGGTGTGGATGTTGGAGGCAAAAAGCCAAGTGTCCCCACGGGTACAGCGAGAGAAGACGCGTGTGTCACGACACTGATGG
ATCTTTTGTTTATACCTGTCCACGACGCCGTGCAATCTTTGAACCCAATCCAACCTGTCTTTTGATGTGCACCGGAAAGAACTTGCGCCCGCTCCTGGTG
GCATCACCACGCGACGGTACATTATACGTCATGAGGCCAAACGCCAACGTGATGAAGGAACCAAGGGCGGAAACTAGGGCTCGTAACGTCAATGGTATGC
TCACACATCGGGTCCTGTCCCAGTCCTTGGAATCGCAATGAAGACGGAGGGGCAGCGCACATTTTTTAGAGTGTGGGTTCAGTCGGAGCAATTGAGCAAA
CAGAAAAAGTCTGCATGGTGCGTTGCCTTTTTCGATGTACGTGACACTGCCCTGCACCTTGCTATGTCGTGGTCTCACAAGCTTTGAAACCGCTCTCGGC
AACTCAAAGTATCCAACGGACTGCAGCGTGCAGCCAGTTCCAGCCGCTGAAAGAAGCCGTCAAGAAAGTTGGCCCTAGTCCACATCTGTTCGTCTCGCCG
TGTACTGCTAACCATTGGGATTGGCGTGGCGGGTACGAGAAGGCGAATTGCAAAGCGACGATGTCGCCTGTCGAATGCCAAAAATTCAATGTTTTGGCTG
CGCCGGGACGTACGTGTACTTACTTGGTAGATGCAAAATCACCAATAATACCACGAGCGAGGTCCGAGTACAGGAGCCTGCGTACGGCCTCGCGCGCGCT
CTGACTCGGTGAGTGGGGTCCACCTCGGGATGGATCACTCCGTACTCACACTCGCAACGACCAAGTCCTGGGGCCAACTCCCACGCGTTTAAGCGCTACG
TATGCAGAATTTTGGAGGTCGTTTTTGCTTCTTTACAGTTAATTGGAACGCAAACACGTTGGGGTGATTGAGAGCCCAGCGACTACCACGGTACAACACG
TGAACAAAATGACGTCGGGTGCCAAACCGTTATTTAAGCTCGATTTCTCTGCCGCAGATAGCTCTGCATGGCTCGATCCAGTTGGTTGCAAAAGTGCGTA
CAATTGGC