Description :
From Genome Similarity Track
Location :
Scaffold_487:3263- 6293
Sequence
3030 bases(100 bases per row)
GTTCATTCAATAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACCAAGAAGCAGAGCTTCGAGCTGTAGAACAGCATTGAAACATTCGACGATA
TTTCACGTGCGGAAGCACAAAGCATTTACGACCTAATTGCCTTTTAAGCAGGGCACGCCTGGCTACTTCAGGCGGAACTCCCACCACTAACCAGAATTCT
GGTACGGTGCGGGAAAACGTAGACTCCCAGTAGGCGCGAGGCTCCCTGCTGGGAAAGAACTAGGTTTTGTTGAGCCTCTAGGAGGTAGAGGAAAGCGGAA
TTTATCCCGAAGGAGCCCCGTGCACTCTACACGGGACGTGAATTCAAGCCAGGCTTGTTGGTCGCAAAGGCGACTGTTAGGGGCTTTGACAAACCCAGGT
CGATTTTGATCGACTCCGATCATCCGGTAATTAAGTCAGACGCTGTTACCTTGAAGGATATCCATGATATGTTGCGGCGCTAAAAGCGCACAAGGTGTTA
TGATCACTGTTCGCTTGGCGACAGGAACGCTAGTCACCGCACCCAAAGTTCCTGTGAACTTGGGTGTGAATTTTTTCGATTTTGAATAGTATCGAACGCT
CTTTGGTCCTTGATTTGGACTCGAGATATGATCTCATTATTGGTATGGCTTGGATTGGATTGGCTTGAGCGCCATGAGCCATGGATCGACTGGATGTCGA
AAACATTAGGCGCCACGCGCACTGCCCCTACTGGAGCTTTGGAGAGTCATGAAACTACCTCTGCTAGGAATCAGAAGCGTTATTGGCGCGAGCCACTGGC
TGAAAATTTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGAGCAAAGCTCGATATGTGATAGTGAA
GCGGCACGTACTCCGCTAAGTGATAGTCGTTGTGAGAGCAACGTACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAGTCATCGAGGGTTGCAACCAT
CAGATGAGCGTGGAGTGGCACGCAAGTAACCACTGAGTGACGTTGGGTGTGATAGGGACGCGCTGAATGTCAATATTAACGTTGTTGGTGAAATACCAAG
GCATCCCGATCTCGGCTCAGCGGATGCACGTGAAGTGACTTGTATTCCACGTGATGAAGACGTCATGTCCAATGACTCGTCATCGGATGTCAATAGTGAT
GTCAGCTTTAGTTTAAAGCAAATTACGTTCGATGATGGTATCGATCAGAGAGATTCGAATTACACATCGTGTGCTATATCACAAAGTGATGATGAATATC
AGCTGTATACACTCGTCAACGGAGTGACTGGTGCTTGTGGTGGTACAATTAGCCTTGAGGCTATACCCTCGTTAAGATCGCTTTCAGAACTCGAAAAGTT
GTCGGTCGATGAGTTTGATCACTCACTTAAGCATTGTGACCTTTAGAGTTGGCGGTCATTCGACCCGACATCATAGAGTTGAACTCTTCTTTACTTTTGG
ATGAAGCCGTTCTGGAGGACACAAAAGCAGTACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGACTCTCATGATCAACTTTTATTCTTTAGTCAAAA
AATTTCAAGATGTGGTGTGCTACGATCCACCCTCTGTTCTCCCTCCAGATAGAGGTGTCCGTCATAAAAGTGACTTAGTTCCTGGGACGAAATACTGTGT
CACACGACAGTGGCCCTTGACTAAGAGCAATGTGATGTCATCGATGACTTCTTCCGTGCTAAGCGCGAGGTAGGAGTGGTACGTGAGAGTAAATCTCCAC
ATTCGACACCAATATTTTTGTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGCATGCTTATACAAGCTTAATGCGGCTACTTTTCCGGCACAGACATCCA
TGCTTCGAAAGGATGTTCATCAAAACAACATGTTTTACTATGTATAGAGGATTCGACTGGTGATAGATATTATCAATTGCTCATGTGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN