Description :
From Genome Similarity Track
Location :
Scaffold_921:3263- 4520
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_921-fgenesh-gene-0.0GH11862

Sequence
1257 bases(100 bases per row)
CCGCCTCAGCCACGACCAGGAGCGCCAGCAGAAGGCGCAGCGCGAGACCCGCTGGCTGCTTTTTTTGAGCGCGCTCAAGTTTCTGGGGCAGGTGCTCTTT
GAATTGGGACGACGGGCGCTGCGCGTAATTGAGCGCGCTGTGCCGCGCTACATCGCGTTCGTCGACCGTCTGCTCGTACAGACCGTGCGCGGGAGTACTG
GTGGGGGCGGTAGTAGTGGTGGTGGCATGTCCAAGCGCTGGCAGCGACCTGCGCGCCTCACGCTGCTGCTGCTGCTTGTGCTCTCGGTGCCGTATCTGAT
GTACCGCATGCAGCGCGCACAGTACGGGAACAGCGTGGGCATTCTGTACGTTTATATTATGTGTGCTGCCTGCTATTGCCTCTTGGATATTTGGATTCAG
TATATTGTATTGGTTCGGCCAAACTAACTGGTGCGTTTTTGTGTGCAGTGAGCGAGAGCTGAACGAAGAGAAAATCCGACCGCAGATCATCGTCGACCGA
CAGGACACCCCACAGGAGACCAAGCGCCGCGCGTTCTTGAGAGCAGGTGGCGATGGACTGCAGACCGACGACACGACGCAGAGCTGCGAGAACACGGTCC
AGGGCGTTGACCTCCTCGCCGACTCGATGGGTACGTACGCGACTCTCCATCAATTGTTCTGCATGTCATACACGCTATTGATGTTGTGTGTGTAATATGG
ATATACCATACATACACTAGGCTACGTGTGCAGCCGATCGCAGCAGGACAAGACCAAGCCCGGCTGCTGCAACGAGTCGGACACGACGCTGCCGCGGATA
AAGCAGTTCTCGTGCGACAAGTGCGACACGAACCCGCCACACTGCTGCGAAGTGTTCGAGCATTGCGTCTCATGCTGCATGCACCCGCTGAATGTGAGTC
AGTGTATGTTTAGGTTTCCTTTATGAGCGATTCATTACTGATGTATGGCTACAACAGGAGAACATCCGTCGCGAATATTTAACGCACGCAGATGCGTCGC
ATCCGGTCTACGGCGACCCGAGCGCGCTCACAGTGTTCCGGTATTGCAAGTTCCGCTGCCGCACTTCTTCAGCCAGTGTGCAGCACCAGAACTCCTATCG
AAGGTGCATGTTGTAGTGTCTTTATACTGTCTCCTGACGATCAAATTTCGTGGGCTCACCTTGGTTTGCATATGATGTGATGTGAACGACAGTCATCGCA
CGTTCTGCTATGGGATCCACCGGCCACTCAAGGTGCTGCCGACTGTCAACAGCGACG