Description :
From Genome Similarity Track
Location :
Scaffold_240:32629- 34016
Transcript NameFunction/comments
Phymu_g7371dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
1387 bases(100 bases per row)
tcctcgatcTGTTCAGCAATGATACGAGCGACGTAGCCGTCACCAACGATGTTGCACACTGTCACGAACCGCCCAAGGAACCAACTGATGGCCACCAGGT
AGCTGTAGCTCGCGGGCACTTCCTCACTGGGGTAAATCGTCGTCCAGATGGAGTAGATCATGACAACACTGGAGTTCGGGATTGGGGCCGTGCCCATAGA
ACCCAGCACTGACAGCAGAAATATGAGgatcagctgcagccaccCCAACGGAACTGCACCTTCCGTCGTGGAGACCAAGAAAACCAGCGCGCATGGAAAG
TAGATGGCCGAGCCGTTCTTGTGCAGGATGCAGCCAATTGTGACCACAAACTGAAGGAGACTGCGCGGAACTTCCCGAGTGGATTCTACACATCGTAGTG
TCACTGGTAGTGTGacgagcgacgaggaagaaccCAATGCAAACATAGCGGCTGGAAGCATGGCGCGCATGTATGGGAAGGGATTCTTCCGCAGGGTGAA
CCAGAGCAACATGGGGAAGAACACGAGCTCGAAGATGGCAATTGAGAGGATTGTGCACAGGATCAGCACGCCCACGTGTCTTGCTGCTTCACCGAGCATA
TCCTGCCCTGACAGAGAACCAGCCACGAGCGACATCACGGCAATTGGACTCCAGTCTATGGCCTTGCTGAtgacgtggaagaagacctTGTTCATCTGCT
TCAAAACGTCGAGAAGGGGACTGCTCTCACGAGAACTCGTTTTGACTGCCGCGGCTCCGAAGGCGATGGCGAACGTCGTCACACTCAGTATCAGACCTTg
ctcgaagctcaagaaaaTGTTGGATGGCACGAGCTGGTTGAGGATGTCGGTGATTTGCTTGGACACTGTAGCGGCGGCACTCACTGTGCCATCCGTCAGA
AGCACTCGTGTCGGGTCGTAGAACTCGAAGCGCGTCGTGCCGTCCATTGAAGTCGCTGAGCAAGAGGCTTCGCCCGTGGAATTGTACGACAAAAAGCTGC
CGTCCTCGCACATGACGTCAAAAAATGCAGAGGATGTCTCGACAACTACGCCCTTGGTTTGTGGCACAAGACCGCGCAGTAACATGGAGATTACGAGCGA
CATTGCAGACCCTACAGAGGACAAGGCCGTGAATATCAGGGCTGTGCGAGTGCCGACGATTGATACTTTTCCGAGCAGTACGATATCGGCCACAGTCGTG
GACAAACTCGTAAACACCATGGGGACCACGAAGCATTTGAGCACCTGCAAAAATATCTTCCCCGGCACATTCACGATGTTGCTGAAATCGTCCGATACAT
TCAGTTTGGACAGAACCATCCCGAGCCCCAAGCCTGCCAACGCGCCTAGCATAATCTGCGTCGTGGGCTCCCGAAGCAAAGCGCATC