Description :
From Genome Similarity Track
Location :
Scaffold_205:32628- 33908
Sequence
1280 bases(100 bases per row)
TTTCGAAGAGCACGGACCATGGTCGATGTATGAGGAGCTACGAAAATTGTATGTTTTTTTAGTTTTAGTGGATGGGAGTCGGACTTGCCTGATTTGATAA
CAAAGACGCTTTTTGTGTTTATTCTTTTGAGGTAGCGAGAAGCTAGGATGAAAAAAGAATTGCAGTAAAATAGCACTGCTTGAAAATTGCAAGAGAAAGT
TACGAGAATTTACTGCTTGCTATACAAGTCGTAGTGTTTCGCGATTTGATCCAAACTCGACGGTCCGTGGCTTCTCCCGTGCGTTTGCGCCACTATTTTT
ATATAGCGTTCGCCGGATTTTTGAGAAGACCAACTAGTAAGGTCATGTAGACGACTGTGTGTTCTGTCACAGCAACCAGCAGCTCTTGCCGACTTAGATA
AAGAAACGCGATTGCATGGTCACGTTTGTATCGGGTGATGATCAACAGGCAATCATATATGCTACGTTGAACACGATGACATTATTGTTGAAGCGCTTGC
GGACCATCCTCGTAACTGTATGCAATCTTGCTGCCATGGAAGCAGGAATCTTTCATGCCCCGACTAGCAGAATCGACATTCGTATGGTCTTCATCATTGA
GTGGAAAATCGAGAGCGTTTGTTCTTCGCCTTTCTTTCTAACAAAAAGGAGTGATCGTTGAAATCACCTGCTCACAAACGAGAAATAACAGGACAATAAA
GCTATACTTGCATACAACCACAAGTATGTTTGCCTTATAACTTCTCACTCACTGTAGAAAAAGCTGTGTCTTCTCGTTCGACTTAAATGCGCTTATACCA
GTCTGACCGCAGCAAACGCTAGTTGCGCGGAACAAACTTCAACCGTGTTTAGTTGCGAGTCATGTGTTGAAAAAGTGGTAACAGGACTTCAGATTGGCTG
CAGACTTTGCTTGCATATGGTACCTCCCTCCGTAACCTCGACTACTACCGTGACCGTATCAAATGTTAGCGTATCACCGTTATCGTCGCTGATCCCGACA
TGGAGTAGCAATCGAGGACTTATACATACTCGTGCCTGCTCCAAGCAGTTTCATTATACTTTGACCGTCTATTTGATCATATTACTTTGGTCGACTACTT
CAATTTACATATTCTTTCTGGACTGACGCGGACACCTGTATCGAGTCCAGCCCCTTCTGGGCCAGTCGAACTTAATGCTAGTGCACTGCTGGTATTACTG
CATCAAGTTCCCCTTCGACCGGTTGCCCTGGAAGAGCACTAGCTCCGACAATGGCCAGCTGGCCACAGCATGTCAAATCG