Description :
From Genome Similarity Track
Location :
Scaffold_8:326277- 333093
Transcript NameFunction/comments
Physo_129562reverse transcriptase
Physo_129563hypothetical protein

Sequence
6816 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTT
GTATACTCCTGCTTCCTCTGTTAAGAAGTGTTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCT
GAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGGGTCCGTTCGTAAGATGGCAGGCAT
CTTTGGGACAGACGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCC
CACGTTCAAGGGCTGCAGTCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAA
ACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCACGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGG
TCGCGCAAACAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCT
CTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTTGGGCCTGCCCGCACGCAACTGTTCCGTGTGCAAGC
AAACACTATGGAGGAGGTGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCGCT
GGCGGTGCGCCTAATGGTAGCTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCT
GTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCG
CCCCAGGAACCAGGGGAACGCCATACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATG
GGGACTTAGCCCCTGAGAGCCTCTGTACTCTCGAAGCGGAGAAGGCCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTT
GAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCATGCAATCGCGACAAGTACGCCGACGCACTACGAGGCAGCAAA
GGCAACGGGCTGGTCTCGGTACGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGGCTTTGACAGCA
CGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGTAACACGAGCCTTGGATCGACTGGCGCGGCAAGGC
TATCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCCGGGGCGCCCGCGAGGGCCGCCAGGGCGCA
GCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACTGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGG
TGGGTAATGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAACAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACG
CGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCG
GGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCA
TGGGCTCTGAGATTCTTAAGGCCCCCCGGGACCTGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTTCCTTC
GGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGC
CGCCAAGGCGAGGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCAT
GCTTATAACAAGCTCAACAGCGCGACAGTGCCTGCGCAAACACCGATCCCGCGCAAGGACGTGTTGCGCAACAACATGGCCGGCTGCACGCTGTATAGCG
CGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCT
GGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGAC
GACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGC
TGTACGCCAACATCGACAAGTGTGTGTTCACAGCTGAGGAGATCAAGGTCCTGGGCTGCTTTGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGT
GAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCC
GAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTAC
AGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTGTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGA
CGATGAAGGCCGCGAACGGGTCATCTAGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAG
TACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAAAGCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATC
TCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTC
GCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCCGGGGTACCGAGACGATGCCAGTCTCGAACCT
CTTGTGCGGTTCTTGGCCACTGGCTCGGCCAAGGTCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGTTATGAGTGGGCTGACGGTTTGCTCC
ACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAG
TGGCCATCTCGGCCGTGAGAAGACATACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAG
ATATGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCT
TCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCAC
TGGCGACGAGGTCGCTCGCCTGTTCATGGACAGTGTCTTCCGACACCACGGTCTGCTCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACG
TTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGC
TCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCACTCTTGGGCTGATCTAAAGAGGAAACGAAGCGTTCAACGATCTTACTATCGTGTGTTGAA
GTGCTGCTACGTTACCGAACATACGGCTTCAGGCATTTTCGTTCGTCGAGCCTCTATACTTACTTCTAATGCCTCTGCCATTCGTCACTTGCCCATGGTT
GAGTTCGCACTCAACAGTGCGGTACAAGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTTACATTACGAGGCA
GTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTC
GTTTGCCGAAGACAGGCTGAACATAATCAGCAGGATGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGA
AACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACC
GCTTCATTGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTTGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGT
ACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGTGGTAAGGC
GCCTGATTCGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGT
GGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCGAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCG
ACGATCCACACGGCCATGGAGACTGCGAATTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGGCCAGCACGAGCGGCA
GCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCG
GGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACG
TGGAACGAGTCGTCCGGGAGCTGCGGCTCCATGGCAAGCGCTAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGGTAACGCGTGGGAGCCCGTTGA
GCAGCTCCAGACAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCA
CGGTAGCAGACGTAGTCGCACCACGCCCATGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCT
CACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCT
TTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCAC
CCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCACCAAGAAA
GAGAGGCTCTTTGTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTTCCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGC
GCACCAGTGCCAGGCTCGGGTGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCAT
ACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTACTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACTCTCCTCGTCCTCAGACTC
CGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGACAGCCGCTTTC
GACGCTTGGGCACGCTCACGACCTTGTGCCCGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCTCGCGTCGCTCGGCGACTTCTCGGCCA
CGACCCCAGCGTCGGC