Description :
From Genome Similarity Track
Location :
contig_47:326277- 327374
Transcript NameFunction/comments
g9247.t1RAW31270.1 NADPH-dependent diflavin oxidoreductase 1 [Phytophthora cactorum
g9248.t1hypothetical protein

Sequence
1097 bases(100 bases per row)
TCACTACCGTTCAACTATTCTCGTAAACCCGGAAAGCTGATCAAACTAATCGTATCTCCGTCGTACTTGCAGGACCATAAAATCTACGTGCAGACACGAC
TGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGCTGGATCCGCGAAACGAATGCCGAACGACGTGTACGA
AGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATGAAGACGTTGGCTCGCAAGAAGCGCTACGTCGTCGAA
TCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTCGGTGCACTTCACCTTTTATGATTCGCTAAAAACACA
CAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGAGGCTCGCCAACCTCACGCAGACGCCTGAGCTGCACG
AGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGATGGCAGGGAGGGCATCGAATCGCACATCCGTCGGTG
GTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCCTACGCCATGCAAGCGTCCACTTGCTGCAGTCCATTCTGCAGA
GCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCAAAGCAGACACGAAGACTCGTCGGCTGACGAGCTGGA
AGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTTTTGATGTGCTGGTAGTACGTTGCTAACGGAGAGGGT
TACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAGCGCATTCGTGTGCAAGGTAATTGTCTCTGTCGCAAT
GTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTGCCTCCACTAAAGAGTTACGCACTATCACCACGC