Description :
From Genome Similarity Track
Location :
Scaffold_74:32627- 34740
Transcript NameFunction/comments
Phyci_280997Cullin-associated NEDD8-dissociated protein, putative

Sequence
2113 bases(100 bases per row)
GACGCAGCAGCTGGGCAAGAGTCTGGGTGCACTCCACGAGAATAGGCGACATATCCAAGTTGAGCTTCGAGCGTGCAATGACTCCGATTGCCTTGATGCT
TTGAACGCGCGTGATTTCGTTGTTCAGGCGCTCCATCAGCAGAGGGTAAACTTCACCCACACGAGGCCCAAGCTCATCACCTAGTCATAATAGCAATAGG
TTAACTAATCAGCTCGTTGGTAATGTCCCCATATCAATCGTTACGCACCCAGCACAGCAATGATTTCCCCAATACTGCTAATAGCAGCCTCCTTGATTTC
TTGGTCGATGTCGTGAACCTTCAAGCTAGGCAAAACTGCTTCGAAAAAGGGTACCGCGTACGGTTTGTACGTCACGTCTCCGTCGTCGGAACGAATAATA
CGGACGAGAGATTCGATCAAGCCCAATGCCTTTGCAACTGTCTTGTACCAATCTCCCTTTGCGCACTGCACGGCAACTTTAACAATTGACTCAACGTGCA
ATCGGAACGGTTCCACGGTGTGCGTGTCAATGAGTAGTCGAAGGAAGAGTAACGCATCCAGCTTAAGATCTGAGTGCTTGTCTTCCACCGCATTCAGAAT
GTTCGGCATTAAACGGCCGATGAAGTCCCCAAGCTTTCCATGCTCCACCATTGCGAGCTCGCTTAGCATCGCGACCACAGCACAGCGCGACGGGACTGAA
GCCTTCGTTCCGAACTGTTTGTTAGCTCCAACAACGATCGTATTTAAGCGCTGCTCCAGCTGAGTAATGCACCCGTTCGACGTGGGTGGGTGGAAAGAAC
CAGCTCCGTTTGAGTTTGGAAGGGTCTTACGAGTAGCGCGAAGAAGCTCTGCAAACACCCCAAACACGTCGATCCGAACGTTCTCTTCACGCTCTTTAAA
CCGTGAGATCAAAGTCTGGGCACAGTGAATGTAGAGCTGCTCCAGAAGCTCCGGTCTAGTCGTGATAATTGCAGTCAAGACTCGAAGACTCGCGCGACGA
ACCTTCCAGCTCGTGTCGTCGTCATCACTGTAGTCTCCTTCTTCATCACTGTACTCCTCTTCTTCTTCCTCCATGTCTTCGTCCTCGTCGGCTGAGTCAA
CGTAGTTGTAGTTCGGGTCGTACGAGATGAACTGCATCACAAGTTTCAGGATAGCTTCCACGTGTGGTGTGATCTCGTTGTGACAACGGATGACAAATGC
TTCAAACGCCTGGAAGCAGTTCCCACGGAGCTCGTCCGAGTCTTCGTTTTGCAGCGACTCATCTTCCGGATCTCCGCAAAACTGCACCAGGATGCGGATC
ACGGCGTCCAGGTGCTGTCCGAGACGGTGGCCTGCCGTGCGCGAGAGCATGCCGATCGTCTGGATGAGCGTGCGGACATTGGCCGAGTCGGAGGATCCCT
GAATGCCCTTGATCAGGTGCTCCACCAGGCGGCTCACCAGCACATCCGACGCCATGACGCCCAGCGAGCCAACGCAAGCGGTGGCGCGCTTGCGTACAAG
GGGCGACTCGTCCGTGAGCTGCACCATCAGCAGCTCCATAATTGTCGCGTGCTCGGTGGCGACATCGTAGCCGAAGCGGCGCAGCAGGTCCGTGAGGATG
TCCAGCGTCTCGGCCTTCACCGCGGCGTCCTTGTCCTTGCCCAGGCCGGTGAGCAGCCGCGTGCAGACGCCCGTGGCGATGGACGCCCCCGTGGGCTGCG
ACACGTCGGCCACGATGGTCTTGAGCCCGATCGAGTAGATGTCCCGCAGCTCCGGCTTGCCGTTGAGGATGAGGTCGCAGAGCTTGGCGCAGATGTCCGC
CACCTGCGCCACCTGCACCTTGGTCACCAGGATGCCCAGGCACTTGACGGCGATGGACTGCACGTCGTTCGACTTGTCGTCCAGCTGCTTCAGCACCGCC
GCGCACACTCTGCACACAAAGACACACGAGCGTCAGCCGCCTCCCCTCCCGGTCTCCCTCTCTCTGGCGACGCACTTGGGCTCGAGGTACGCGCCCAGCT
CCGCGTCCTTGTTCAGCTCGACGCAGAGATCCGATGTAGCCATGTAGCGCTCATCCTTGTCGAAGTCCGTGGTCTGCAGCGAGCACGAGAGAGAGAGAGA
GCATCAGCACCCA