Description :
From Genome Similarity Track
Location :
Scaffold_26:326241- 328681
Transcript NameFunction/comments
Phyra_77757Hypothetical protein

Sequence
2440 bases(100 bases per row)
ACTCTCAATCACGAATCCAAAGCCATTTCCACATTTCGTGACTCTTCAAACCACCAGAGATGAATGCCCCGATGGACGACGCGGCCATGGAGCAGTACGC
TGACGTACGTGACCCGCTACCATTGCATATTAAAGCTCGATGAATTGTGTGTGGAATCGTTGATGAATCCCCTCCCACCGCCTCGTGGTTGCGCTGCACA
GTGGTTGGACAACTTGGAGAAGACGGATCCGGAGGGCTACAAGCAATTTATCGCCACGATGCAGAGCCAATTGCAGGCTGCAGGGTTGGGACCCGAGTCG
GCGGCGGGTGCACAACAGGTTGACACCAATGCGGCGCTGTTTGACATACTCAAGAGCTCTGCAGGAGCACGGGGAGGAGCCACAGACAGCAATGCACCAG
GTTTGAAATGGCACAAGGGAAGCTTGGTTTTTGGTGGTATGAAGTTTATTAACGTGCTGCATTATGCAATTAATATTTGTCAGATTTTAAGCCGCGGTTT
CCTGGTGACAAGGTCATGGGAGACGACGGCCTGAAAGCCACGCCGGAAGGGGTACCTTTTGGCTTGCTAGAGGAAGGGTGGAGGAGGTGGAAGGCACTAA
GTAAATATGCTGCTGGTTGGTAGATGTACATCGACGTGAAGCCTGGATTCGTGATGAAGACGAGTGATGTCAAGAACAAAAAGAAGGTCGTGAGCTTGCT
AACCTCGTATTCAGCCACCAGCGAAATGTCTGACCTTGTCCGGTGCTGCATGGAGTAGGTGTTCGTGAATGTGGTCTACGCCGATGAAATCCAGGCCTTC
TCTGAGAAGAAGAAGCTGGATGAAGAAGGCAAGGAACAAGAGGTGAGCACCCTTGTACCATCGTGCTTCTGGAAAAGTTGCTTGAGCCAATGGCATAACT
TGCGGTTTATGGTCAGGGAATTCATGTGCCACTAAGTCTCGGGGCGCCCCATGAGGTTCAGGACAAGAAGGGCGTGAGTGCGCTGGCATTTGACGTGGCG
GTGAACACGAAGGTCGTAGAAGACTGTCAAGCAGACAAAACAGGCGCATTCCGTAACTTCGTGTGTGAACTGGCAACAGAGTACATCGACCAAAAGGTAA
GACGCCTTTTCCCGTAGAAGAAAAACTAGGCAAAGTTAACTGATATGCTGCGCTGCATCCAGTACAAAATCAAGCTCGACGACCGCTATAAGCTGCCCCG
GTTGACGTACCGCGGAGAACTACCCCCGCCGAAGCACTACATTCGGAAAACCCAGGCACCAATCATCCAGGAAGTAGTTGCTGGTAACTCCGGAGTTTCC
AAGCAAACAAACAGAGCGAAAATTACAGCACAGAAGGCAGCAAAAGCTGCGAGAGCGCCAAAGACGGCGACAGCGCGCTTTGAGGTATTCGAAGAGCGCG
ATGGTAATCGTACAACGTGCTCAAGACCCCACTCCGCGATGAAGGGCGGTGAACCATTATCACCAGAGGCACTTGAGCAAGCCGGTTCTCGGCTTATCAT
CTCTATTCGGTTCGAAAACATGGTGCAAGCTGCCAGTGATGTCGACCTGGAGCTCCAAGCCGAGCTTCTAATTGTCAAGGCGGCCACTCATCATGATTTA
GGTATGTACAAAGGTTTTAGCCACTTTACTGTGGCGAGAACTAACAACTTTGGCTCTGCTGTGGCCTCGTTTAGAAATCTTTCTTCCGTATCCCGTCCAA
GTAGATACTGCAAAAGTTTGCTTGGATCGAACCAGCAACTCGATGGAGATAACTCTCACGATCGCCAAGTCCTGGAATACTGCTGGTCCCGATTGCGGCT
CTGCACCGTGGCTTCTTGCGCGAGCATTAAACGAGGACAATGAGGCAGCTACTCCAGCAACTAAAGATGGAGAAACGACAGGCGGTTCTGTCCAACAGAA
GCCCAAGTCACTGGTGGAGTTGTTCCACCTCGCGAATGCCGCCGATTCGAACGGAAGCCCGTCTAATGCTGGACCTACATCGAAGGCTCCACGCTGGGAC
CCTGTCATGGAAGATGAGGAGCTACCAGAGGACCGATTCCACCGCAAAGACATGATGTCGATGCACATTTTGGAGCAACGACGGATTGAGCGTGAACAAA
AAGCAAAAGAATCGGAAGATAAGCGAAAGACGAGGCGCACCGAAGTGGAGGAAATGCAGAAGAAGGCCAAAGAGGCGGGAAAGACCTGGCGCGAGATGTA
TCCTAACGAGCCAGAGACAACCTACATTGACATGGAGGACATAGTGCGGCAGGAGAAAGAGAGACTTGATCGCCACCAGCAACAGCAAAAAGAAAACGAG
GACCCAACCAGAGAGTGCGTGACTACCGAAGACGCGAAGCGTGCGGCTGCAAAGTGGTCCGAGAACAACAAGCACGGAAGCTTCGACTTGCAATCTGCAC
TGGCATTTGATTTACTCTAAGATAATACAGATTGAGCCAC