Description :
From Genome Similarity Track
Location :
scaffold_365:32624- 34260
Transcript NameFunction/comments
g7697.t1 Folate-Biopterin Transporter (FBT) Family

Sequence
1636 bases(100 bases per row)
CCAAGGACCCCGATCGTCCTGATCAAACCGGTTACACAAGCGTGAAGACACCCGATGGTACTGCGGATCTAGAGGGAGGTGCGCTACGCCCTGGTGGTAT
GCCCGTGTTGACGAGCAGGGATAACATTGGCATCCTGTTCCAGTATGCTGCGGTTGGCGTCGTGTATGGCATGCTCCCATCGACTGTGTACCCCGTGCTT
CAACAATACCTCAACTGCAGTGGAGCTCAAGTCTCCGCAGCGAGAGAGCTGGTAACACTACCCTGGAGCTTCAAGGTCTTCTTCGGTATCATTTCGGACT
GCTTCCCGATCGGAGGTTACCGTCGTCGCCCGTACATGCTCATTGGATGGACAGTTTGCATCTTAATGCTGCTGGTTATGGCTGTCATGCCAATTGGTGA
GCCGTACTACACCGTCGCGTCGGACCGTGATATCGATCCAACCGACTACACTCCGGAGATCGAGGCGCGTATCAACTACGACGCCTCCAGTCAGGGCGCG
AAGTATGTGATGCTCATGTTCCTGGCCTCCTTTGGGTACGTCTTCTCCGATGTCTGTTCCGACAGTATTGTGTGTGAGCTTGCTCAACGGGAACCCATCG
CAAAACGAGGCAAGACCCAGTCTGCTATTTACACAGTGCGAACTGTGGTCGTGATCCTTGGTGAACTGCTCGTCGGGTTTTGCTTTAACGGCGAAGAGTA
CGGCGGTGACTTCGACTTCTCGCTGAGCTTCCCGCAACTGATGATCATCATGACGGTGCTTACCGCACCCGCAATTCCAATCACCTGGTTCTTCATCAAA
GAGGAGAAGTCGCAGCGTGTCAACTTCCGCAAGTACATAAACGAGTTCTGGGACCTGCTCTGCAAGCGCGTCGTGTACCAAGTCATCGCGTATCATTTCT
TCTCCGGTATCTTCTCCAGCATATCGTACACGGCCAGCTCGCCGGTGCAGTCGTACATGGTGGACGTGACACCGATCAACGACACCCTAAACAACGTCTT
GAGTCACGTGGCCTTCATGATCGGTATCATGGTCACGTCCAAGTACGGTCTCCACTGGAGCTGGCGAGGTATGATCGTCTGGACGGGTATCGTCGTCATC
ATCATCGACTGTTCTGTAGCATTGATCACAGTCTGGGACGTGTTCCGCAGCCAGTGGTTCTGGCTCGGCCCTCCGATTGCTGTGCAGATTCCGAACGGCG
TCTCCTGGATCATCGCTCTGTTCGTGACGGTCGAGATTGCTGGTGTTGGCAATGAAGGCGCCGTATACGGTCTTGTGACGACGGTGGGTAACTTGGCTTC
CCCCTTCGCATCGACGTTGACTCTGCTTATCGACGGTCCGTTCAACATCACCAACGCCCGTGTGCAGTCCGACGACTACTCGGTCCGCATGGACATCACG
TACACGATCATCATTTCGTATGTGATGACCATCTTCTCGTGGGTCTTCCTGGTTCTGCTACCGAGGCAGAAGCAGGATACGCAGGAGCTTGCTCGAACGG
GCGGGTCGAGTAAACTGCTTGGCGGGTTGACCATCGCGTATTTGTCGTTTTCACTTGTCTGGTCCGTGACGGTGAATACCCTGGCCATCTTCGACAGCAC
CTCGTGCCTCCTCATTGCTGGCGGCTCCGGATGTTA