Description :
From Genome Similarity Track
Location :
Scaffold_35:32621- 54262
Transcript NameFunction/comments
Phyag_g906hypothetical protein
Phyag_g907hypothetical protein PHYSODRAFT_249195
Phyag_g908hypothetical protein
Phyag_g909hypothetical protein PHYSODRAFT_494196
Phyag_g910conserved hypothetical protein

Sequence
21641 bases(100 bases per row)
GTAGCATTCGGTGGGTCATTCACATCTACCACTGCTACTACAAGTGCGTAACTCGCAGAGATGTCGGAATCTACAACAGTTATGTTCAGAGAGTGGGTAG
CTTTATCCTCAAAGTTCACCCCTCGTTTTCCCACATGCATGTAACCAGTTGAGGAGTCAAAGTAGAACGTGCCAGGGATACTTTGATTCTCCAAAGAAAA
CTGCAAAGTCGTTGACCCCTCAGGATCGTAGAAAACCGAAGTAATAGCACGATCAATAGGGGTTCCCACGGGAACGTTTTCAACCACTTGAAGTGTTCCG
TTCGATAACAGTTCAGGAATTTCGTTttggtccagcagcgtgatTGCAAACATTTTCGCCGTAGATAGCGCCTGCGGGGATGAATCTTGTACTGAGACTA
ATACTTGAAATGTTTTCTTCAGTGTTGCCACATCAAGTATTCGGTACCAGTCAGAGGATCGGAATTTCACATCGAGTAAATTCCCCATACGCAGACGTGG
AAGTTCAAATGCAAGTCCCCCAGACACGACAACGTTGCTGGTACCCATTGGTTGTTCTGTCGTGTTAACAGCATGAAACAGAGCACCAGTCAAATCCACA
CGAACCAATAAAACGTCTCGTAGTGAGACGGCAGGGTCTGGGTTGCTTCTTGTGTAACGTAGCTCAATAAAAGTTTGCGTTCTAGATTCACTGACAAAGT
GAACGCCGGTAATGTTAAGCTGATCAGTACCTTGTGTCCTTGTGACAACTACAAAGCTGGGAGCTAGCAAATCATCAAAGATGAAGGCTTCGTAGTCGAA
ACAGGACATTTTCGAGACGGAAAGCTGCCCAGATTGTGCCCCAACTTGCAAACACCCATCGCTGCTTTGAGAAATAATTGAGAATTCGATGGTGTCTCCT
TTATCAGGGTCATAAGCAGCGATAGGTAAACCGATAAGAGATCCATTAGGCATGTTTTCACGCAGTGTGAAATTGCCATCAAGAATAACGGGGGGTTCAT
TTACATCCAGAACAAAAACACTCATATTCGCGTCCGCAGTAAGATTTCCGCTGTCAGTCACCCGAAACGTCAGCACGTAGAAGTTCTTTTGCTCATAATC
CAAAGTGTTCAACAGGGTCAACTGATTATCAGCGCTTCTGTAATCAAATGGACACATCGGGTCGCTGCACCAGATAAGCCTCAACTTAGACGTGTCATTG
ATatcttcgtcagcaacatTTATTGCGGTAGACAAGTTCACATTAGCAATGCTGTTTTCTTGTATGTAGATGTTGGATACTGCGATTGTAGGCGGCTCGT
TGACATCGGTCACGTTAATTGCAGCAGTAAACAGAGAAGACAGTACAGGGTTCCCGTTATCGGTCGTCCTTACTGTGAGAGCGTAACGATTTGTCTTCTC
AAAGTTCAATGGAGCACCCAACTGATAAACAGAATATGAACTTGCCCCTCCACAACTTTTTCCTGGCGAATCCACGCAAAGTGTATCACATGCTGCTTGA
GTGAGTCTGTTTTCTACCAAACCAGGGACAACGTTTCCACACCAGCATTCGGAACTGAAACCTAGGGCCATGAATTGAGAGGATAAACATCTGTGAAAGC
AATCGTTGAATGGCGTAGAACTCCCAGAAGTGTTAAACGGTCCCACTAGCCCTGTGCGAAGCTGCGAGAAGCACCCTGTAAAGTTCTGCACTGGTCCTTG
ACTAACTCGAAGTCGTCCCGTTGCAGAATCCACAGAGAAAAAATTGTCATCGTTTCCACCTACGATATCAAACGACACCTTCTGGCCGATATCAGGATCC
GTAGCAATCAGAATACTTCCGATTGAAGTTCCAACACGAGAATTTTCGGGGATAGATCTCGTTTGATTGTTGCACACGGGGGCTTCATTTTCGTCCAGAG
TAGCAACTGTTAAGTATCCATAGGCAGAGAGGGGATTTACATTCCGTTGCTCCATGATAAGAAGTTTCAGAGAGTAACTCGGGTACGTTTCATAATCCAG
TGTCGGATGAGCTACCATCAACGAATTCATGTCGATGGAAAATGCATCGAGATAGTTGCCATCAACTATAGAGATCACCACGTTGTCGTTCTCAGGGTCA
TACACGCTAATCGCTCCAATCACTGTACCGACAGTTGCGGTTTCCGAGACTTGCATGATAGAGTTAGCTGCCAGCATCGGTGGTTCATCCACATCCACAA
TCCAAATCGTCACCATTGTCACAGCGAATAGATTGCCACTGTCTCGGATACTTACTTGCAGATCGTAGCGATTCTGGGTCTCGTAATCGAGTGTAGACGT
ATTGCTTTTAATGTATCCCGTCAACGAATCGATTTTAAACATTGAAGCGAACTCGGTACTTCGTAAAGCGTATGTTAGGTTTGCTGCACCAGtgtcatcg
tcgtccgcAAGTATATACTGGGTCGGAGCTACAAAAAAACAAGAATGAACATATCATGATCACGAGTCCACGAAGGGAGCATAACTTACCATATGAAATA
AACCGCGAGGATGGCTTGTTGGTATTTCGAAGATACGACGATGTCCCCCAAATTGATTTAGCAGAATCCCAGTATTGAACTGCTACAACGGAAACGCAGT
GCTCAAGCTTACTGTCTGTGTCAAGAATCACTTTGGATGCATCGACATAGAAATTGAACTCAAGCATGATCCATATACCGGTACCACCAACTGAATCAGG
ACCAACGTAAGCGACAGTACTCGTGTCACCATCGGTTGCGTTACGAAGATCAGATCCGTTCGACGACGTAAAACCCACAAGAGATGTAGTCAAGTCAACC
CGCATGCGCTCTGAAAACCAagcaagttcagcaacaccgaAGGACAACGCCCCAGCGTCGGACAAGATTGCCAATCGCCATTTCTTAGCCGTATTTCGAG
CTGATTCACTGATCGTGGGGCCATTTCCGAACTGGGCAATGCTACTACCTGGAGCGATTAAATCACTACACCGTAATGTTGTGTCACTTAGGCCACCGTT
AAATCTGTaaaagaaaaacaagaaagATACGTGTTAGAACATGCTTGAAATACAACAGCGGCAAGTGTTGGCAGTCGGTCCATGACACCTGTAAGACGCC
AGTAGGTTGGACTGATTTGGGCTGACCGAGCGAGCAATGTTGGAATGTACGGCCTCAACAGATTTTGTGTGATTCCACAAGCGGAGCTGCAAAGCGCAAT
AGAATCCAAGATATCCGTGAGCACATTCTTtaaagaaaaaaaaattgtATCACAAACTCACAAACCTCGTCAATGGAGAAGATAAATTGCTTTGCTGGAC
AGTTGATGCCATTGCCACAGTTGCCAACAGTAAGTGCAGCTGATGCGCTCCATATTATTCCAGTGCGAGAAAGAATTGATTGTCGAAGAACCACCCCTCC
ATCGATGAACACAGTTAACTCACCACGGGTACTATCGAAAGTTACTGCGACATGATACCACAGCGTGGGTACAAATGCCATGTTGGTGTTGATAGCAACT
CCGTGTACAGTGATTCTGAGATTTCCTCCAACATATTCGAGTTGCAACCCCGTCGAGGATGTAAAATTATCTTTCCACGCCACAATTGATCCTTCGTTCG
TACTTATAGCAACCCAACACTCGAGCGTGAAGTCAACGATAGGCACAGGTGCTATCTTACCTTGTTGCACATAGTGGGTATCATTTGTAATCAAAAGCGC
TTGGTTTGCTGAGCGGTCGGCAATACGGTCGAATCCTCCACAGGCTGGGCATGgtgcacacgctgctggTAATATACTATACAAATTGCACTGGGAGGAG
GAATAGTCGAAAACTCCCGCCTCACAAGAGTCCAATTGTACACACAGACGTAAGCAACTTCCATACGATACAGCAGCTTGACTCGCAATTCTAGTGGTCT
GGTCGGCAAAGGAGCATGCGCCTCGCGGCCTGAATCTTGATGATGTGATTGTGCTCACAGCTGAATTTTcttcgatgaagaagtgtTGGTTAGTTTCAAA
GTATGGCGCCTCATTGACGTCGATAATTCGAATGCCGACGGTTAGAATCGTCGATGCCTTCGATAGATCCGTCGCTGTTATCTGAACAGCATAAGTTGAA
CGCGTCTCGTAGTCAACTTGTTTTGTAAGAACAACGCTATACGTCGTGGCGTTAATTGGCGCAATTGAGAAGGTTGCAGAGGGGTCTAGTAGCACTATCG
TACATACATCgccaacgtcttcatcaaaaACAACCACAAGACCAACTACGGTACCAATAGCGGACGTCTCGGGTACGGCTCCACCTCCCACGGTCACGCT
CGGAAAGGTAGACTGAAATGTCACCTGGGGTAAGTCATCTTGATCCAGGACCACAACGTTGACCCCCACCAATGTACTCTTTGCAGGTCGAAACGCGTTC
CTGACTAATAAGGTGATGTTGTAAGTTGTTTGTTCTTCAAAATTGAGTGCTTTGATTGCCCGCAATTGACCTGTTAAATAATCAATCGCAAACTTTTGAT
TGGCGCCAACAAGTTCGAAAAAAAACGCGGTCGAATTGCCGAGGCCCGTATCTGGATCAGTGCAGTTTTTCCAAATGGTATCTCCAACAGGGGCGCCAAT
CAAGTTGTTTTCGGATACTGTAGCGGATACCATTGTGGCACATACTGGAGCTTCCAGTTCGTTTAAAATATCGACGAGaaaagcgcagcagctgcttAGA
GGGGCTGCAGCATTATCTCGTACACGAATTTTTAGTGTATACTGGCGCTTTGTTTCGTAATCGGGCGAATTAGTTCCCACTGTAACCACGCCGCTCGTTG
AGTTCATATGAAAGACGTCACTGTCATCACCAGAATCAATGTAATAGGATACTGTATCAATCGCATCTGGATCGCTCCCAATAATAGTGCCGACAGCAGT
TCCGTACGGCGAATTCTCCAAAATTTGTGCCGTCGCGTTACTGCATTTTGGTGGATGGTTAATATTACGTGACAATATATTCACCGTAACCTCGGTGTAT
GTCGAAGTGATGATCGTGTCCGTAACTCGCAGCAGAATGGCAATTCGTGCATCATCGAGGACGTAAGCTCCAGGGAGAACATACAACTCACAAGCCGttt
tgtcgctgcttgttCGGATCGCGAATGTACTCGTTGTAGATGTGATGGAACAGGTCCCGCCAGCCTGCCCTGGGTCTCTATCGCTCACTGGTAAAGAGAC
GGTGGCGTACGATCCATTACCCAACTGGTTAATGTCGATATTGAAATTAGTCTGTGTTGCAGTGGCCCCAACGAAAAAAGGCGGTGAAGGTACCAACTGC
ACGGCAACTGCTATTGGGGTTGTCAAGCCAGTCAGCCCGGTCGGGTCTGTGGCTTGGACCACTAATTTGTATCCACTCACAACTTTAGCATCCAGTGATG
AGCCAACAGTTAGCGCGCCCGTCGATTTGGATATAACAAATTGGTTCAACGGATCGCCAGAGTATATCGCGTAAACGAGTTGTGCGGTCTGTCCAACATC
TTCGTCTGTAAAAGAATAGAAAGCACCCAAAGCCGACCCAATAGTTGCTGTTTCAGGAATAGAcactgccattgctgctgtgctcaTGACAGGGGCATCT
GGGCCATCCAAAACCTCGACTGTGTTGGGACCAACTTCAGTGCACAGGTTGAGCGGGTCGCAAATGCTAATGTTCGCCTGAAACAAGTGAGTCGGCAACA
CCTCGTAGTCAATTTCAGCCTTTGTCACTAAATTCCATCCTTGGACCACGAAAAGATTGAAAAAACCTGTAGCTGCGTGCACTATTGTAAACACAAGCTT
GTCTCCTTCTGGATCAGAAGCCTGAAAAGTGAGGACAATCGTTCCGACAGGTACATTCTCTATAATCTGTTTCGTAAACACCGAGCCAATAGGAGGTTCG
TTTACATCAATAATTTGGACAATCATGTAGGCCGCGTCACTGCCACCTCTTTCATCTTGAACACCAACACTGAGATTGTACGCAGAGACTGTTTCATAGT
CTAAAGCCCCGACCGCCCATAATTGAGAGTTTTGAATAGAGAAGACAGAGCTGCTTGATAGCAAAGAAAAGGTAAGTATTGCCCCCTTGTCCTCATCGAA
AGCAAAGTTTGCAAGGTTTCCAGCCAAACAATCGGTGCCAACACAGTGTTCTGGAACGCGAAAAATAGTGCTTGTTAGCACAGGGAAGTCGTTTGAATCC
GTGACATTGATGTTGTAGTCGCACGAAGTTTGAAGAGCCGTTGTATCCGTAAAACGAACTTTGAAGAGAATTGTGTCCTGGATTTCAAAGTCGAGAGGTT
TCCGTAACGTCAGTTTCCCAGAAGTAAGGTCGATAGAGAGTGTTCCTTGCACGCTTTGAGAGACTAGTCCGTATGAAATGGAATCACCGGCATCCGGGTC
CGAAGCATGATCACGCATAGATCCAATCACAGTTCCGACAGTTGTGTTTTCAGGAACACTGAACGAGAAAGAAGCGCAAACTGGTGGTTCTGGAACGTCT
TGAACCACAATTATCACATTCGCGTGACCTTGCAAGCCACCTTTATCCGTAGCGACAATATCCAATACAAACTGGGGCGTTGTTTCAAAATCGAGCTGTT
TCGTTGCAACGACAAACCCGTCTCGGCCGACAACAAAACTTCCATTTCCTCCGCTAGCGATAGACAGTGTATAGGAATCGTACGCATCCGGATCAGTCGC
TCCTAGCGCTGGTGCGATGGAGACCGGGGGTAGCGTATTTTCCTTAATCACACGAGAGGCTTGATAATTGGTCACGACTGGAGGTTCGTTGACATCTACC
ACGTTCACATGGATTTGGCACGCTTGGTACGGCACGGTCGATTGCGCATCTTGAATTAAAAGTGTCAAGTCGTAGGCGTTTTGTGTTTCGTAATCTAGGG
GCTTTAGTACTGTCACGTGATTTTGACTATCCAGTGCAAATAGACCCGCAATCGGGGTGCTCAGCGCATACACCAGCCCAGTAGAGGGCGTCACGAGACT
AAAACTGACACCCGAAACAAAGGCAGGGTCGTTTTCGTTGATGCTCAAAGTGTGCTTTCTGTACACACAAATTGAATCTGGAAACACGTAAGCCAGAGTG
CGAGCACCACCAGAGCAACTGTATCCTGTTGGACACCTCTTTAGTTCGTACAATCGACCATTTAATGCGCCCTCAGGAATACTATAATAGCCTGCTGGGA
CACTGGTAAAGTTGTAAGAAGAGATCGCCTGAGAGAGCGGTAGAACTAATTGCAAGCTGTAACTGGATCTCGAAGCCACTACTTcaaatgttgctgctgt
ggcgtTATCATTGACTCCAACAAACACGAAACCAGAAGATGCAGAATCAATCGTTGCCTGAGAAATGCCAAATGATATTATCCAGGATCGAAACGCTGGC
GGAAGTACTGCCAGATTTGTACCAACGATAAGGGCGATTCCACCAGGTCCCATCGTAGATAATGTGGGCATATAGCTGTTACTTGCCGAAGCGTTAATAC
TTGTGGAAAAACTTTGAACACCCATTCCAGAGTATGCCAGTATCTCCAAAGTATTCGTCGCTTGAGCTAGGTTCCTTACAACTTCTCCGTTAATACTCAC
AGTGCCTGTGCAAGTTGGTGTTGTGGGAGCACACAGAGCGATATCGATTTGCAGAGATATGGGTTGTCCATCCAAGCGATCACATCGTAGAGTGCGAAAA
ATTGCGTCAGGGGTCTTCCTAAATAGAATAGATCTCTTCACGGCAAACTGCGACTCTGCTGCGATTATGGACACGAGATGTCGACCCCATGACGACACAA
ACGAAAAAGCGAGCGTGCCATTTTTTGATCGCGGAGTCACAACATttccatccagcagcacaataGCACCCCAATCGAAGCCAGCGATCGGCATTTGGAA
ATCGTACGTCTGGTTGACCTGCGACTGCTCGAAATACGAAATCGAGATATTGTGAGCGAAGCCGGAGGACCACCCCGTCTTAAACAATGTCAAATTAACG
TCGCTGAATTCGAAAACATCGACCGACACAGCTGCACCACCGCCCACAGCTGAAAGAACACTTTGGATATGAGAGTCGTTGGTGTCACCGGGTTGCTTCG
CTAGTGGCGCTAGAACGTATGAAATTGACGCTGGGGGTAAAACAACTTGCCCGGCACCACTCGAGGAATCCGGACAGAGGCTGATGCTTCCGGCCTTGCA
TACACAGCCTATAGCACACCGGCCAGCGCAAAGCGGGTTAATCAGGCCTGCTTGGTCTCCGAATCGTGTCGGGGGGCACTGGTATGCGGTTCCTTTCCGG
CAATAGTATCCTCTTGGACAAGGTGACATTGCGGATTGTTGTTCGTTTACCATTGACCCGACAGAGTAGTTTCCAGGTGGTACGATGACTGGACCAGTGT
TTCTTTCAGGGCAGTACACGCTTCTAGACGGGCATAGCGCTAACGATGTGTAGCCGCAAGCACCTCCACCTAACGAACAGTAAAATCCAGGTGGAACCGC
GCTGCAATTTTGCTGCCCAGGTTTAGAGTATGTTCCATTCGTGCAAGATAGGAGATTGCCTCGGGACATTTGATCAAATGGAGCTGCATAACCCTCTGGA
GCATTTGTGCAGTCACTTGACCCCGCATCAGCGAACGTGCCCGCCAGACATTTTACTGGTGTCGTCGAACCACTTGAGCACTTGAAACCAGGTGGGCACG
AAAGGCATGCTGCGGCACTGGAAGACCCAATCGAACTGCTGTACGTCCCCGCTGAACAAGTAGTGCAAACTTGAGAGTGCGGTTCGGAATAAGTGCCGGC
AGCACACTGTGAACACTCTCCAGGCGTGGAGCTAATATATCCTGGAGGACATTTATCTGGCCGTAATAAAAGAGTAGCGGATCCATAGCCATCCACATTA
TTCCACACGACTCCTCCCGTTTTCTGGCACCAGCTCTGCGCCCACGCAGCGTAAGAAGTACAAACCGGAAGCACATCAAATGGCGCGTTTAGATCCGATC
TGGTAGAGCTGAGGCAATCTGCATACCAGAACCCGCTTCGACTTTTCTTGGCGCAATTTTGAGTCGCTGACAAGTCATTATCCTGATCTGGTGTGCTGAA
ATACGTATTCGAAAGGGGGTTCAACGCATCCGTGGCAAAACTTGCTGTTGCGTTGTATCCTTGAACGGTCAAAAGGTACTTTTCGTTTTCACTGGCAACT
CGGAAGACACTATAAACTGCGGCTTGAGACTGATAGTTTTTCGATATCACGACCATCGCTTCGGTAGCCCGTACTGTGATGTTTGCGAGAACATTGTTTC
CAATCCACCATTCATTGTAAGAGCCCAACCCGAATCCATCGCGGTATTCATTCCAGTTGCGATTGAATGTTGTTTTCCCGTTAATGCGCCGCTGTGCAAC
GATCCAGCCGTCTGAGCACGGTAGAGTTACAGGATCGACGCTGGCGTCAAGTTGAATGTAGTACAAACCGTCTGGATTCAGATCTCCATTTGATAGGCGC
TCGTTTTTCAAGTGCATGCACGACACTGCCGGACTTGTCATCGATAACCCAAGCGGTGTTTTGAAAGACGACTCCACCTCCATTGATACCTCATCAACCC
CAAAAGCGCTAATGTTCAACGTTCCAAAATCAATCTCAAACCGAAGTTGGGTGGCATTGCCATTGAAGCCCCTCACCACAAAACGCTCCCTTCCCCGGTA
AAAGTAGGCTTGTTGAGAGGAAGTAGAGCCCTGGCTATAGCATGCGAAGGTCACTGATGTGTCGACTTGAACCTGTCGAATCAGCTGAGATCCGAGTAAA
ACTCGGATAGTTTTTGGCTCAGCGAATTTTAAAAGAAGTGTGGGCCAGTAGAGTGGGTCAAACACGAAGTAATACGTAAACTTGACGCGTACGCTCGTAG
GTTTGCCACTCGTGCTGATCTGAGCCACAGTTTTAGTGACATATGAGCCGGGTCGTGCGAATGACTTGCCACCAAGCATCACAATTCCTTGGCAGAGTTG
ATACCATTTATCTGTGCTGCTCCACGACGCTACCCACAGATTATCATCACCAGTCCCAATAAAGGAGTCCTGAAGAGCGAAGCTCCACGATGTAGCAGGG
CTTACATCGTTTGTTGAGCACAGATATTTAGTCGTAGACAGACCACGTGGATCAAAACTCAAGGCCAAACCATCGGAGACGCTCTGTCCAATGAAAGCGG
AATACATTCCAAGCCATCTTCGTTCATCTGGTGCATTGGCTGGGGAGACGGCGTCAGCGCAGCTTCCGTTATCACGTAGCCACCATTTTCCACCATCAAT
TGCAGTCCAATCTAGCACAGTATCCTCATCACTTGGTAAACCAACCGCATCACCAACGTAGGCATTAGTGACTCCAGGAACGGTTGAGAAATATAATGAA
CCATACTTTTGGTGCATGGATGCCAGGTGCCCTGACGAGCGGGGTACAACTTGCCGAAGGCCCATTGTTTTACAGGTATCACTGTCTTTTGGGCTAGTAC
TACTTTGGCAATCCATATCGCTGGTGCCTATATCGCACGGAACAATAGTATAGCCCTCGCCGCTATCAGCAGTCATATTGCAAAATGCATCGAAGATCCC
TGTGGTAGTAGCAATAGCATACCGCCCACTTGTTGCATTAATCGCGTCGGTCTTAATTGCATGGCAACTAGGAGGCATATTCAAGTGAACAGTGCTTGTG
GCAGAAGCGTTGTAAGTGCCGGATTGCATATTTCGTCGGAAATCCGCGGCTGTAATCGCATAGCATGTTCCATCTGCGTGAGTGAATCCAACACAATTGT
TGCTGGATCGGCAAATACATCGGCAGCGATCTTTTAGCGTGTATGTATCAGAGCACACACTCGTTCCGCATGCGCCGCCATTGCATTGCGTCAGCACAGA
TACATTTTGGCTGAAAGCAGACCACATAGATACATTTTGGCTGACAGACCACTTCGTGTTCCGAAGAATTGTCCACGCGGTGTCCGATATAGTCGAATCT
TGATTGCGCACGAATGTCAAACGTGTTGAATCCGTcgtcagcgacgacgtgttgCGAAGCATATAAAGGTTGCATGCGCTAGTCACACTGTTGTATACGC
CTAATCGACAGAGGCCGTGCCTTGTGCACCGTGATTGACAAAAATCCTGTGAAAGCAATGCGCCTCTCTCGACGGCGACAATTTGTAATTGCACTCCTTT
CAGTTGGAAGCCTGCACTTGACATCGTTTTTGCATTAACCGTAATTGTGTGTGAATCAGCCACTGCGTCTACGACGGAATGCATCGTCAAAGGTTCGCAG
GTTCCATTCGCTACCGTCCCAGAAACCGACATGAAATCTccatcgaagagctggtcTCCGTTTTTCGATATTCGCACACGTAAAGTCTCAGTGGCTGAAT
TGCGGCAAATAATACCAGCAACGCGGATGACTAGTGTACTTGGCGAAGAAAGTGTCACTGATTTCGAGAATACTGTGGCATTCAAAGACACTGTACTGTC
ACTGAACGTGTCCGTGGTGAGCGAAGCCGCTGGAATGAACACTGCTGTCATTCTGCCGCCAATTATTTTTCCCGTTTTCGTTCCTTGGTACTGATAACTG
AGAGAAAGATTCAGTGCACTAGCCGTCGAAACGCTAGCGAAGTAGGAATAATCGAGAGGCACTCCAGATGGGTCAAGGAATGAATCGTCTAAGTGAAACA
ACGACACGGGTGAAGCAGAGCTGGTTCCGAAACCGAGATCTAGTCGAAAGGTCTTCACTGTGCTCTTGTCCACAAAAAATCTCCCCGTAAACGTACAAAT
AAAAACTCCGCTCGATGAATACGGAAGCGCAATCGATAATCCAGGTATTGCAGTCCACTGTGAGGTCACCGCTGTCGGGAAAGCTACTTGAGTCGCTCTT
GCATTAGCCCACGCAGTGGTCGGTAGAAACGAAAACGAGACGAGGGATGAAGTGTTAGCCTTGACGCATTGCGCATCGTTCGTCACCACTGATGCTAAGT
GAATTGCGAACCGTCCGTCGACAGGGGTACTTTTGAACTGCAAAACTGAAACTCCTCTCCCAACGCTGCTTGCTTTATTCGCTTGTTCAGTGGTAAGCGT
GGTCGAAATCGTAGCATCGGGGGCGACAAATGGTGACCATTTTGTTAGCTCCGCGACAATAGCAGTTACAGAAGCAATCACTGGCGTCGACCCCTCTCGA
CTGAAGTACACTCCTGACGTTTCAAATTTCATCGAGAGTCCGTAAATCTTGAGCACATGAAATCCCGGCGTGACTTTCATGTCCACCTGGGTAGTTTTAG
AGATAACACTTTTCCAATAATTTGTTATCCCCATCAAATCTTGCACAATCACTCCATCCAAaaccaccacagcaccaTTACCAAGCCGAAAAGGAAGTCC
AAGAAACCACGACCAGCTTGTAGCAACAGAACTGGGCTCCACGAACTCCACCTGGAACAGAAATCCCACATTCGTATCCACCTGCTTAAACCTTCCACAT
AAATCACTTTGAGTGTTTACTAACGGACCCAGTGCCGACAACTCCCGTTCACAGAACCCATCACTTTCCAcgggcgcagcagcagcgtcataATCTTTTT
GAAAAATTGGTCCTTGTCCAGCTTTGTAAGCTGTGGCTGAAAAAGACTTTGAGGAATAGGACATCTTCGCGTACGGACTcagcgaagctgcagccacaat
TGATGAGTCTAAAAAAGACCTAAATCACCTGTTGATACTGCCAACGTACTCGGATAATTGAGCCTGGCTTCCAGCACATTCTCGGTATAATATTTTGGAT
CCTGCAATTTAGAAATATTACCATACAAATTGTTAGAAATttgttgacgacgactacTATTTTAGTTGGGGTTTCTACTGTTCTGTAGTTGACGTGGGTC
ACGAGCACTCCGGCGCTCGGGGTCACGAGAGTCGCCGTCCTGTCGCCATCCAGATTGTCATACACGACCGACGGCAGGACTGCAAATGCAGCTGTATTGG
TCAACAAACTAGAGATTTCTATCTATATTCCTGTAAAGGAGGTGACTGTGGCACTCACACGGAACGAGCTCCACGTTTGCGTCGGCCGGTCGAGAGCtgg
cgaaggtggtgaagtTGGGCGCCGCGCAGGCTGCGggctggaagaggagggtCCAGCCGACGAGCACCCGCGCGATTAAGGAACGGAGAGCCATGTAAGC
TTGAGAGATCTGGCAGCCTGTCTCGTGGTGACTACTTGTGAAGATCCAAAAGACAACTTGACGAAAATTGGCCAATCGCGTCGCTCAATAAATTCAAAGT
CAGCGGCATAGTCCATGAACTCGCATGGAACTACGTGTAATCTTAACATCGAAATGCAGTGATGAGTCGTTGCTTGGGTCAAGATCTGGTGTGGTCGCTG
TTACTGTTGTTGCGGTGAGAGTGTGGGCATCTTCTGCCTTACAGCCGCATGCGTTGTGAATGGCAGCACAACTGCGAGCACTACAGCGAACCGAAGCTAC
ATGTTGCAGGCTGGAAAAAACCACGGCTGTATTTCTTGAGGAATGGAAAACTAAGGTATTGGATTCGGAACGGCTTTCATCGCGCAAGTGTGGTGCACGT
CGCTGCTACCAGAGAAATTGGGAGGCGCATTATAGTTGTTTTATGTCGGATGAATTACCTCTGTACCAATCTTACGAGCAACCATTTTCCTTCAATTTCT
TCGGCTCTGTTGCGGTTCCACGTAGGCCATGTCGTCGGAGACACATTCGTCAAGCACAAATGACAAAACATTTTGAGTGTCGTATTCCTCGGTTTTAACT
TTTGTCTTCCTACGCTAGGTTTCAGCAACACCACGGATGTTCTAAAGCCTTGAAAACAAATTTCAAAGACCAGAGAAACTACGCCCAGAGTTTTTGGTAG
CTAGCTACAACTAAAGTGAAGTGGCTACCGTCGGGGTGCTTGACTATTAATTGGGAAGCTTCAAACTGGCAATCTGTTTTTGGTACTGCTCGAGCCGGAG
CTGCAATCTCTCTGCCAATTTTTTTGTGCTCGCGGACGCTGCCGCCTTTTGTAGAATCTGGACTAGTTTTTCGTCACCGTAATTAGCCACCAATGTCACT
ATCGGGCTCGTGGCTCTTTTGGGGTCGGAATTTCGGTTGACCTTCACGTAGCTGGTCCATGTGCCGAATAAGGGGCTGGAGAGAAGTTTGTCATCAGCCT
CGTCGAGTTTCAGTAGCTTGAACACGTTGTCCACGGATCGCTTGTTTTCGATCCATTGGCCCATTTGAGGTCAATGATGACCTTGATTTCCATGTCAGGa
aacttcttgcgcttgtcaaTCAGCTTTTGCGTGTAGCAGATGCTTGAAAGAGCAAACATGGTCACACAGATTGACTCCGTGGCCGAGTCAATGTCTTCGA
GAGCCATCTTGTCGAAGTCAGCGTCCGTGACGGAAGACTTGACCTCGCATCGACTCGAGTTGTCGACGTAGACCCGAGCGGCGGGtaggagctcgtggag
cgtGGACTTGTTTATATCGAGGACCTTGGCGAGGTCCCGCACCGACCACTTACGCTTGTACTCGGGGAGGCggatcagcttcttggccacctcgatGGCC
GAGTGGCCGCGCAATGGGCGACGTCCTGGAGGGCGTTGCCGGAAGTTAAAAACGCGGCTTGCGTTTTTAAGCCAGCTTCAAGGAGGAACCGTGAGGAGGA
CCGCATTCTGGAGCAGTCCTCGAGGCGAGGACTCGCAGCGGAGTCTTCATGCTCTTTCAGTGCTGTCCGCTTCGTGCCATTCGTTCTCGTAGAGTAGTAG
TTAGCAGCGTGGCCGTCGTCCGTAGCATGGCTCCTAGGAACTAcagcttttgcagcagaCAGAGGCTTCAGCAACTCGCGGCGGCTACGGCTTCGTTATC
TGCACTTTTGGTGCTTTTGGCACGAAGCACACGAATAGGATAGGATAGAATTGCCCTCGTTCCCAGGGCTTGTGTTCTGGTGCGAGCACAGTCCTCGCTg
atgttgcagcgctgggaaAAGCATCTGCATCTTGCTTTGGCAAGTGACTTGGACGCCACGTGCTTGCTTGTCCGCATGGACATGTCGGTAGTGCATACCG
CTATGCTCTACCAACCGCACAATCCATTGCGCAATCATTCACCTTCGTAACATATAGCATACACGTAGGTACTTGGAACCTCGCCAAGTTCCTCAACGTA
AAAAATAAATAATAATAAGCAGGCCTCTTTAAGAAATTGTGGTGCCTTCACTCACTGCGAGTGCTTCATCACATTTTAGTGCGGATACAACTACTCTATA
ATGGATCGCTTTGCTCTCTAGTAATCAATGGCTGGGCACAGACAGCTCTACGACCGTCGCGTGGTGTTAAACAAGGGGACCCACTATCGCCGTTTCTTTT
CGCTCTAGCTCTTGAGCCACAATGGAGAATCGTTAGTCTTTGACTGATTCCTCTGGCAAGAGAAATAATTACCACTTGTGCACGACCATTTGCCGCCACA
ATTTGGAAAGCTGGGAGTGTACCAATCTGTATTGGGGAAAGAAGGCAAAAATGACCACTGGCTGCGGCAACTCTCACACGATCGGGTTGCTGCCCAGTGG
AGACCAGGACGAAGAAACTTTCGCACGGCTTCGTCAGAGATGCGCCAGGACTTCGCGTAAGCGATGACAGCCAAACACTCCCTAACAATAACAAAGAGGC
GAATTACATGGATTACCAGTTCAACTTTACCTTCCATTCTTGAGTTGCCTTTGCTTCATTCCATTATTATGCTGACCTTATTGAAATGTCCCGTTCAATT
GGTAGTCGTAGTCTACACAATATTCGTTTAGGTCAGAAGATCAAACCACATCAACAGCCACACAATTATTTACTCTCCAATTCCTCTAtgagcgatggca
gcgtcgCCACTTCAAGTGCACGTCTTTTGCCATTGCGAAGATTGAAGAATCCCTCGAGCGATAACAGGTTTCGTTCATTGCCTTCATCTCCTAACCCATT
TGCAGCCAACAACAGGATACGCACAACTCGAGTCCAGTCACGCAGCGTACAATGGAGAATCTCCACGGATGTCCACAGCATCCAATCGAGCTccaggacg
aagaagctgctcgacgattGGGACGTGACCTTCCCCACAAGCTTCGTACAGTGGCGTGCTGTGACTCGAACTAGAACAGACCAAGTTGATGCAAGCACCT
TCTTCTATGAGCACTCGCACATGCTGCTCCCAACcattccaagctgcaacttgcagcaacgagtcaccacctgctgctcaTAGAGaaataataataaaat
aAAGTAGCCTGGTCATATAAGTATGTTCCCCCAACGTGGTTGCATTGTTGGCAGCGGGCTTTTGCTTCCAACTATGACATGGAACGCAGCGGACGACGCT
GCGGCGGCAACCCATCGCTAGAGACCAGATTACTAAACGATTAACGTGATTAACTAAACGCGCAAGACCACCGGAAGGACGTCAAGATGGTGAATGGAGA
TCCAGATTCTGGCGCAGAACTGCCGGTAGATGCCTCCTTTTACATGTACCCCGGAGGCTTTTAGTTGCTTCAGAACACGAGGATCACATGCAGCTCATCT
GTAGAGGCTGAAGTTTTATGCTGAGAATGTTTACCAGTCGCAAGTTGCGACTCGCAACCACTGGTATACAAGTTTTGCTCGATAATGAGTTCAGGTTGCA
ACCACGACAATCGTACGACGCAGTGATGCGATAGCCGATAGGGTAGTGCTTTCCGTTCACGATAAGCTTACCGCTAAGCGGCGTCAAACAGATATGCAGG
TAGAATCCGAATCAAAGCTTCTCTGCTTGCACCGCACTCTTCATTCTTGAAAACACTAGCTCTCGAGCACACCCTCCAAGTCAAGATGCCCCGCACTACC
ATCTCGCTCGCTTTAGtcgcgactgctgctgtcgtcgtgaACGCTCGCCCAACGTACGTGGCTCGCCTGCCCAACGGCGACAACGTATCTGGTGTCGCGG
CCTTGGGCCACGTTGATcctgctggcggtggtgccaACAATGACTTCGGTCTTGACTTCGCGAGCGCCGGCGATGCATGGACGACGGAGTTCTGCCAGAA
GGACTCGGACGGCGACGGCCAGACTAACGGCCAGGAGCTCGGCGACCCGTGCTGCGAGTGGTCCCAGGACTCGAACGCCGTCGTCCGCTGGACTGATGGC
GTCTCGCACCCTGGTGACGCATCGTCTACTTCGGACGAATCTCTGTGGGCTTCTATCACCTGCGGCTCTTCCACCTCGAACTCGACCACGACCAGCTCGG
GTTCCAGTGCCGGTACTGTCGAGGCTGGATCGACCACCCCTACTACCGAGACAACTGACGCTACGACACCTTCTAGTGCcacggcatcttcttcgtctgc
cgcagcttcttcgggATCAAGCGCGGCTTCGGTAATGACTCCTGCAGTGTACTCGGCTGTCGGTGTTATTGCGGCTGTTGCAGCCTTCTTCGTGTAGGGA
TGGATCAAGGTATAAGAGATCATTTCATCAATTGAACTTGTTTCATTCGTCGTTATGCCTTCTGCCATCACTTACTCAAGGGAGCGCTCTCGAAGTCCCT
CGCGGTTTATACAGTGCCCTTCTCTCTTAGAAGTTACGAGGACGCGAGTCCCTGACCCCGGCTGATCTGGAACGTGGTGTCTTCCGCTAGCCCTTGGTGC
ATTTGGCAGTGGTTGCCCTTCCGAACCGAGCGGCTGCAATCGTCAGCCTCGCACCGACGACCTCCACCGTGCGAGATGCAATAGCCGTTGCCAcggtcct
tcttcttgcagtcTTCCATGATGCAGCGTCGGATTCCTCCGTGCAAGTAGCACAACCCGAGGCGTTGAGTTCCTTTGGAGCATCCAGGGATACGACATTT
CTTACCACCTCCGTGGGCACGGCACAGACCTCCACCTTGTGAGCTCTTGTCGCAACCGGGGACTTGGCAGCGTGCACCACCTCCGTGAGTCTTGCATCGG
TTGTTTGACTGTGCGCGTCGTATGCACCCCTCGGCAATGCATTGCTTGGCTCGTCGAGTCCCTTTCGATCTGGttgacgaagccgacgatgcagtcgaag
ttgtcgaagtaTTGGAGACTGTGCGCAGAGTTGCAggaggaagcggaagcgATGGCGCCGTGTACTGCACACTCTTTGTCACTGACTGACATCCGAGTGG
CGACGGAAGGGGGAGCATGTAGCTATGCGGGAGCGGATTCACACGACCAGGGGTGACCGAGATCACGAACGGGTTTGAGCCACCGGCTGTCGGCTTCAAG
GAGGACCGGACAGACCTCGAACCTTGACTGACAATGTCATCCCAGGACTCTCGCAGGAACGAGTCCATGACCGGCGAGAAGTCAGGCATGTCGCGCTCTT
GCTTGATGAAAACATCGCCGCCCATAGGAGTTCGACCGCCGATACGGATCTTCAGATCAGGTGAAAGGCACGAGTTGGCGCCACCGTTTACACTCATCGG
AAGAGGAGACTCCGTGTCCTGCGAGCCGAATGCGTCACTGATCCCTGTCAACTCCATGCTGTCCGGATCTTCACGTCGGAAAGCGGCCGTCGGCGTGGAT
GTCATTGAAAGGGTCCCCGTGTTGTccagcatcatcatcgtGCTTTCGaagtcttcatcgtcgaggAGATCCATCGACGCCGGCAAGTTAAAAAGATCAC
CAAGCGTCGTGATCGGCTCAGCTCGGGGATCCATGATTGACCTTAAGCTTGCTTTGAAGTTGATGTGCGGTGTCGTCCGGGGATGAAGTAGCTGCGAAGG
CACTTGCGGTACAGAGCAAAACTGAAAGTGAGGGAGAAGCTTGCGCGGCAGCGGCTCCAACGTTTTAGCAGTTAACGTGCATTGGTGACCGAAGGCTCAA
ATAAGGCTCTTGGAGCAAGCCGTGTGGACTACGGCCTCACCATATgagtcctcgtccaccttctGAGACTTATTAACGATTCCATTGGGTTTGGTAGCAG
CCTCGAACTGCAACCCCCTAGTCACGCTGTTGGGCTTCATGTCATGCACACCATTCGAGAGGACGAACCTTGACCAAATTTGTCCATCATAAGAACCAGA
ACAACGCTCGTACGGTGAAAATTAAGTGAATTGCTACTCAGCTTCACGTTGCAGCACCACCTAGCCTAAATGACCAGAGCCTGCTGGATAAGCTCGCTTT
GGGTCTTCAGTGCACAGCCGTACATCATTTTGCTGAGCCCGTTGAGGGTAAAGTTTCGTGCGTTctcgacgtcttctgctCGAGCCGCTAGGTCCGGCTG
AACTTCTGCGTAAATGCGCAGGTAGCTTCGCACAACCGACCCATGATGTGGATCTGACTCGTTCTGTGTAATTGTAGTCCAAGACGGCGACCTGAACTCC
AGCCCTTGCGTCAGCAAGACAATTGTGTCGGCTTTTGCGATAACGACGCGCTGAGACTCCTCAAACTTGCGGGAAAAGTGACTTCCGTTGATTTCAATAT
CACTCTGCTCTCCACGCAGCTTCATCACGAAGTTTTTCTCCAAAGCGTTGGGTTTGCTACCGCGCAGCTATAAGTTTTAAAAATCACAGTGCGAATGCTC
AGGTTAGttgcaggtgctgcaaaAAAAGTATAAGGATGAGAACTCACGTAGCGATAGCGCTTGTCAGGGATTTCGTGCACAGTCTTGAGGTCCTTCCATA
ACAGTGCGCACGCTTCTTTAATCGAGCACGAGAGAGGAGTGACAGTCTCGATCTCGATAATTTTGCCGTACTGTGTGTTGGGGTTGACGTTCATTTTGGA
GGTCACCAAGCACGGTAGGTCCCACCCAAACCCGGCCTCGGAATCGGCATACAGGTTTTCCACGCGCTTTTCCAGTAAATGCATTATCCCAGCGCTATTG
TCCACAGCTTGTGGTGATCGGTACAACGGAGCCGGACCACCAAATACGAGCTCCATACCCtgtagcaacagcaccaaaagACAAATTAGTACTAGAAAAC
CGACCCTATTGGAAACTCTGCCACACCTCAAGAGCAGAACGCCGTTGCAATATCGCTCGTAGAGCCTCAGCTGTGTGTTCTTGGCTCGACAAGATGGCTC
TGAGTTGGCGGTTGGTTTTCTCCGCTTGCTGTCGGCGTACGAACTGACTCACTGCTTGGCCATACCATTCGGAATTCGCGGTGACCGAACCACCGAGGTC
GGGTTGAGGTCTTGCCAGTGCTGCATATTTGGAACGCTTTAGTAAATCAAGCTGGGCCTGCAGTACGAGTGTTTCTTCGCGCAATGCTAGCTTCTCCGCT
TTCttgcgctggagctgtcgcgTAGATGAGCTAGCAAAAGTCTTGACTCGCCTCTTCTTAGCCTTAGCCTTAGTCTGGGGCGGATCCGGTCGACTCGCAA
TGACATTTCTCGACGGTCCCCTACTGTTTTCTCCGCTGTGATCtacctcgctgctgcttgcgtttGAATCGGTTGTCTCCTCTTCAGTTCCGCAGGAGTC
GATGAAGGCTAAAGCTTCCGCCACTACGCTCGGGTCATCATCACCAACCAGGAAACTCATCGTGATATCAACTGCAAGGGAGAGATTAGAAGCCGTGCGG
CATGGAATTCGGTCGGTGCCAGCTGAATTCGACTGGGGGTGATTAAAACACTTGGCGTCAGGGGTGATTTCGTTGATTACCGAGGCGTTTAGCCAAGATG
TTGACGGTGTTCCACACCGTCAACAGAATGATGATAACGTTAACTTTGTTTGCCTCAAGTTAAGCAATGAATCACGGAAGTTCATTGAAGGCGGGGTCTT
CCACACTTGGTGATCACAATTAAATTTGCTGCAAACGCCTCAAGCCGTTTTCCAACCACTCTCGAAAGCATGTCCAAGTTTACCAAGTTCGCgatcgtcg
gcgctggaggcgtcGGCTCTGGCGTTGTTGACGGTTTGCTCAAGGCTGATGCTACTGTGACGATCTTGACTCGTGATGACACCAAGGTATGGTATCTGCT
ACAAGAATTCATGCATACTGTTACCGTAGCTCACCGATGTATGTGTGCAGACTGAACTTCAACCGTTCAAGGAGCGCGGGGCATCTCTCGCAAAGGTGGA
TTACGAAGATGAGGTGTCATTGAAGGCAGCTTTGAGCGGCAGTGAAGTCGTGTAAGTGCTTTTTGCCTACAACGTTGGCTGACGACGTGAGCTTACAAAC
TACCTTTGTTTCCTGAACCTTAGGGTGTGCGCGATCCATGCTTACCATCACGCCACTCAATTCGCTGTTGCTCGTGCAGCAAAGGCTGCGGGGGCTGAGC
TTTTCGTGCCTACTGAGGTACGCCTTCTTACCATTTGCTTGCCCGGTGCGGCAGTCCTAACACGTGTGTTGGTCTCCAATAGTTCGGAatggctgaagaa
gacggacCGAACGTCACGAAGCAAAAGGTCCGCGCTCTGCTGAAAGAGCTTGACCTGCCCTTCGCCCTCTTCCATGGCGGATTGTGGGCCGAGTACATTC
CATTGTGAGTTGGCACTGCACTTATCAGGAGGATCGCACGCACTGACCTTGCTGTTATTGTTTTGCTGTAGCTTCGTGGGGTACAACTTTAAGGAGGGCG
TCATGAACGTTGTCGGTGAGGGCGATGCCAAGATGAGCATC