Description :
From Genome Similarity Track
Location :
Scaffold_1283:3262- 4846
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1283-fgenesh-gene-0.1Replication factor C subunit 4
Pytap_DAOMBR444maker-pag1_scaffold_1283-snap-gene-0.4WD domain-containing protein

Sequence
1584 bases(100 bases per row)
TCGCCGCCATGTTCAGCCGCCAAGGCGCTTCAGCTGCCGCCGACGTGGCTCCCACGGCGCTGCCATGGGTCGAGAAATAGTATGTACGCCCTTAAgaCAT
AGGCTTtCTGATGGCTGACCCATGCTCTtCCTTTGCTCAGTcGCCCCAAGAATGTGGACGAGATCTCGCACCAAGAGCATGTCGTTGCGACGCTGAAGAC
CTCGATCCAGAACGGGCAGTTGCCACACCTGCTCTTCTACGGCCCTCCTGGCACCGGTAAGACGTCGACGATCGTCGCGGTCGCGCGCCAGCTTTtCGGT
CCGGATTTCCGGAAGAACGGTCGCTTCCTCGAGCTCAACGCCTCGGATGATCGTGGCATCAAGGTCGTGCGTGAAAAGGTCAAGAGCTTTGCACAGGGTG
CCATCAGTAGTGCTTCTTCGAGCATGCCCCcGTTCAAGATCATTGTATTGGATGAAGCCGACTCGATGACGACGGACGCGCAATCGGCGCTGCGTCGCAT
GATGGAGAATTACTCCAAGGTCACACGATTCTGTCTCATCTGTAACTATGTGAGCCGCATCATCGAGCCGATCGCGTCGCGTTGTGCCAAGTTTCGTTTT
GCGCCACTCGAAAAGGGCTCCATGGCaTCCCGCCTCCGATACATTTGCCAGGAAGAGCGAGTTCAGATTGAAGATGAAGATGTGACCGAGACTTTGCTCG
AGTGTTCCAACGGAGACATGCGTAAAGCCATCAACACGCtaCAGAGTGCAAAGCAACTCTCGGGTGgaGAAGCTATCACACGTAACGACGTATTGGCTGT
CGCAGGGGTACGTGGCTGCTGCTGCAAGTGTGTTCTATGGCCTGCCATTTGACTGACTGTGTGACTTGAAGCTCGCACCTCCGGAGATTCTCGAGACATT
TTGGCAGGCAGTAGCATCTAACAACTTTGACAAGATGAAGAACGAAGTGGAGAACATCCTCCTGGCTGGGTATCCAGTGACCACGATCTTTGAACAACTG
AGTACCGATATCCTCAACCACGCCAAGCTGAACGACACCCAGAAGGCCAAGGTGTGCTTACGCATCGCTGAAGCGGACAAGAAGCTGGTTGACGGCGCCA
GCGAGCATTTCCAATTGGTCGACGTCACCTCCTATGTCATGCGCGTCTACCACACGCCCTAGAATCACAAACGCACGCACCAACCAGCCTTTGCTCTAAC
TCAAAATAATCCTCTCTTCTTGCTTAACTGGGGCAAGAGCCAAGTGCTCATCCTACGATCTTGgcTCCCTGTTCAGTCACAGATGACAATTGCACCCATG
AGTGGTCCGAGTTCTGCTTCCAGAACGTGACTTCGTCGTCACCTGCGGCCACACTCAGTACGGTCCCCGTGAGCGACCAGCTTATCCGGTACACAGGATT
GCGGAaCaTGTGCACCACTTGAGGTGACCATCCTCCGTTGGCATCGTTCTGCATCCACACGCGCACAGTGTGATCATCcGAGGCCGAGGCGATGACGTTG
GcGGgAACgCCcAcGTtGGgaGCCCacGACACGTCTCGGACCcAGTCGTTGTGgCcgTAAaGGggCTcACCcACTAcGACCCAC