Description :
From Genome Similarity Track
Location :
Scaffold_74:32618- 34995
Transcript NameFunction/comments
Phyci_280997Cullin-associated NEDD8-dissociated protein, putative
Phyci_525945hypothetical protein PITG_01501

Sequence
2377 bases(100 bases per row)
GAGACTGCTGACGCAGCAGCTGGGCAAGAGTCTGGGTGCACTCCACGAGAATAGGCGACATATCCAAGTTGAGCTTCGAGCGTGCAATGACTCCGATTGC
CTTGATGCTTTGAACGCGCGTGATTTCGTTGTTCAGGCGCTCCATCAGCAGAGGGTAAACTTCACCCACACGAGGCCCAAGCTCATCACCTAGTCATAAT
AGCAATAGGTTAACTAATCAGCTCGTTGGTAATGTCCCCATATCAATCGTTACGCACCCAGCACAGCAATGATTTCCCCAATACTGCTAATAGCAGCCTC
CTTGATTTCTTGGTCGATGTCGTGAACCTTCAAGCTAGGCAAAACTGCTTCGAAAAAGGGTACCGCGTACGGTTTGTACGTCACGTCTCCGTCGTCGGAA
CGAATAATACGGACGAGAGATTCGATCAAGCCCAATGCCTTTGCAACTGTCTTGTACCAATCTCCCTTTGCGCACTGCACGGCAACTTTAACAATTGACT
CAACGTGCAATCGGAACGGTTCCACGGTGTGCGTGTCAATGAGTAGTCGAAGGAAGAGTAACGCATCCAGCTTAAGATCTGAGTGCTTGTCTTCCACCGC
ATTCAGAATGTTCGGCATTAAACGGCCGATGAAGTCCCCAAGCTTTCCATGCTCCACCATTGCGAGCTCGCTTAGCATCGCGACCACAGCACAGCGCGAC
GGGACTGAAGCCTTCGTTCCGAACTGTTTGTTAGCTCCAACAACGATCGTATTTAAGCGCTGCTCCAGCTGAGTAATGCACCCGTTCGACGTGGGTGGGT
GGAAAGAACCAGCTCCGTTTGAGTTTGGAAGGGTCTTACGAGTAGCGCGAAGAAGCTCTGCAAACACCCCAAACACGTCGATCCGAACGTTCTCTTCACG
CTCTTTAAACCGTGAGATCAAAGTCTGGGCACAGTGAATGTAGAGCTGCTCCAGAAGCTCCGGTCTAGTCGTGATAATTGCAGTCAAGACTCGAAGACTC
GCGCGACGAACCTTCCAGCTCGTGTCGTCGTCATCACTGTAGTCTCCTTCTTCATCACTGTACTCCTCTTCTTCTTCCTCCATGTCTTCGTCCTCGTCGG
CTGAGTCAACGTAGTTGTAGTTCGGGTCGTACGAGATGAACTGCATCACAAGTTTCAGGATAGCTTCCACGTGTGGTGTGATCTCGTTGTGACAACGGAT
GACAAATGCTTCAAACGCCTGGAAGCAGTTCCCACGGAGCTCGTCCGAGTCTTCGTTTTGCAGCGACTCATCTTCCGGATCTCCGCAAAACTGCACCAGG
ATGCGGATCACGGCGTCCAGGTGCTGTCCGAGACGGTGGCCTGCCGTGCGCGAGAGCATGCCGATCGTCTGGATGAGCGTGCGGACATTGGCCGAGTCGG
AGGATCCCTGAATGCCCTTGATCAGGTGCTCCACCAGGCGGCTCACCAGCACATCCGACGCCATGACGCCCAGCGAGCCAACGCAAGCGGTGGCGCGCTT
GCGTACAAGGGGCGACTCGTCCGTGAGCTGCACCATCAGCAGCTCCATAATTGTCGCGTGCTCGGTGGCGACATCGTAGCCGAAGCGGCGCAGCAGGTCC
GTGAGGATGTCCAGCGTCTCGGCCTTCACCGCGGCGTCCTTGTCCTTGCCCAGGCCGGTGAGCAGCCGCGTGCAGACGCCCGTGGCGATGGACGCCCCCG
TGGGCTGCGACACGTCGGCCACGATGGTCTTGAGCCCGATCGAGTAGATGTCCCGCAGCTCCGGCTTGCCGTTGAGGATGAGGTCGCAGAGCTTGGCGCA
GATGTCCGCCACCTGCGCCACCTGCACCTTGGTCACCAGGATGCCCAGGCACTTGACGGCGATGGACTGCACGTCGTTCGACTTGTCGTCCAGCTGCTTC
AGCACCGCCGCGCACACTCTGCACACAAAGACACACGAGCGTCAGCCGCCTCCCCTCCCGGTCTCCCTCTCTCTGGCGACGCACTTGGGCTCGAGGTACG
CGCCCAGCTCCGCGTCCTTGTTCAGCTCGACGCAGAGATCCGATGTAGCCATGTAGCGCTCATCCTTGTCGAAGTCCGTGGTCTGCAGCGAGCACGAGAG
AGAGAGAGAGCATCAGCACCCATGCAGACAGCACAGCCAGCCAGCCATAGCGCACCTTGTCCAGCAGCTGCGAGATCTTCTCCTCGTTCACGCGCATGGT
TCTCTCCCCAACCGCGTCGTCCTCGGCTTCGCTACTCCAAAGTGAAAGTGAGTGACGAGAGGAAGGATCTCGCTGTGGTGTGGCGCACACAAAATACACC
GCCGACCGTTACTTCAACTTCAGTCCGCAATTGGCTCGAGTGACCGACTGAGTGACTGACCTGCCCGGACGCCGACG