Description :
From Genome Similarity Track
Location :
Scaffold_14:32616- 36301
Transcript NameFunction/comments
Phymu_g1003hypothetical protein

Sequence
3685 bases(100 bases per row)
TTACTCAATTCATTTACGAGTTTATAGTTCAAGTAGGAACAGAACGTGTGCGGCGGCAAGCGCTAGTTTCGTCGATGCCATTGCTAAATCGTTCAATTTG
GAGCCGAGCGCTTGAACAACCCGAGGATCGAGCTGTTGCAATTGCCTCTTGTCACTTCGAGTGGATCCAGCCCAGTCTTGCAGCCACTGGAGTGCCAGCC
AAATGTCACCTTCGTCACCATCTAAAAGTGACAGAAATGCTGTACACAACGCGTTTCGTGCCATTGTGGACAGAGTTTCCATGCACGGAGTCTTAATCAT
CGACATCGTACGCCGTAGCAACGCCAAATCGTCTTCGACTATGCACAACCGGAACGcgagctcgaactcgccGCATTGAGCTGCCTCTAAAGTAGCTTCA
GCCCGAGTGAGCTCGAAATTGTACACTGTGTTGTCAATGTAGTTGTTATCTTGGTTACTCTGTGAATTGTCAGGAGTTCGCGACGATCGGTGAGCTGTTT
GAATGACATCCTCGTGCTGTCCACGTTGAGATCGTAGCTGTTGTCTCTGCTTGGCTGCGAATTGCTTTAAAGTTGTGACGGTTTGTAACGCCTCTGTTGC
TGGTTGTGTCCGTGTAGATCTGTCGGAATTCGACGCTAAACTGTAGCTTCTACGCTGTTTACCTTGGACTTCACTCTCCTCAAGTTGGTGATGCTCACTT
TCATCGGCATTTTCTGGGGCAAAGTAGTCCATAGCCGATTCCGTAAAAATatcatcatcttctgcagACTGAAAAACTGGAATACTGGTCTGCACAACTT
GTTTATCAGCTGCCGCTTTAACTATTTTGCTTGAACTAGCAGCGGATAGTTTGTGTTCGACTGGTGCGGGGTCTTCATCTAGAGTAACTTCATCTGGTGG
CAAACCCtgatcaccttcttcatgATCGAATTTCACCACATTTGAGTCTTCTGTCGACTCGGACTGTAAAAGACTCGAATTACGCTTAGATTCATTCAGC
AACGAAAGGGATGCGCGAGCGCTGGTCTCCATAGATTTCGCCCATCGTTTACCAGTAAACGAGTAACCTGGCGGATTGGGCGGAACGAAGTCGCTGGCAG
TCGCTTTGACCTGGAGCTTGCTTTCTGCTTGTGGATAGATTTTCTCCAGACATTCAAATGCCATAGTCACTGGGATAGCAGCTTCACGAACGAGAGAAAC
GGAATCATGACGACCTGCTAGAACGAGAGCTCGAACTCGCTCCTGAAGTTGCGTAACAAGGCAAGTGAGACTCAGTTTCGAAAACGAAAGGCAATAAAAC
CTACCAGTTGCACTTGAAAATATCCTTTTGCAGTCTCAACAGAGACACACCAAGTAGATTCCTGCAAGGTGAATATATCGAGGATTAgagtcagcagctc
caagcccCGTTTCCGTAGCATCCAGTCGTCCCGAGGTCCACATTGGAAGGCGTCTTCGATTGCTTCGTAGATTGAGCCGATGTATGGAGAAAAATCGTCT
CCAAGCTGCGTAAAACCTCCTTTTTCGTGAGCATTTCGTGCTAGTTGGCAGGCCGATTGAAGCAGGAGGAACAAAGGGGAAAACGTGGGGAACATCATAC
TCCCATCCATTTTCGCTACGGTATCTGCCAGGAGAATCTTGAAGAACGGACGGATTCGTGTAGCATGAGCGAGAATTGTACTTGGACCCGGTACTGAAAC
TCCATCAAAGTCGAGGGGATGGAGCAAACCACAGAGGCACCTGGTGGCTGCCTCACCCACAGCGTTGACTTCTTTCGCGaacacagcagccaccgccTCG
AACGGTTGAGTAGAATTGTTTTCACGTTGtcttcgaggagaagaagcaccaggGAGTGAGATCGTTGGGCACGGCAAGACGTACAGGGCAATGGCCGACA
CTAAAATCACACATGCGTCCGTTATCTTGGCATGTCTGTCGCGAAGACGAAGGCAAGCGTAGGATAAAATTCGGGGTAAAATCTTCGCTGCTTGAACCGG
ATGACACCGACATAGGGCTGCGGTGAGGAGGACAAGCATTCGCCGTGTGGATGAGCGCACGGGTTTCTTCAAGTGAAGTTAGCGTTTGCCAATTGTTAAT
AAAAACAACACTATTTACCTTGTTTTTCTCGATCAGCCCATACACTTCTTTCACCATTGCTGGGTCTAGTCCGGGCAACAGTTCACTGCACAAGGGATAC
GCTATTTGTTAGAAAACTTACGTTTTCGCAGCAAGATAGCCATTTCTTACATGAGCGTTGCGAatgcttgctgctgcgtgtctCGATCTTCCAAGCGGCC
GATTAAGACGTTTAAATGACACACTTCCTGTACTTGTCGCTCCTTGGTTTTACGGTCcagttttttcttcttaATTGTTCCTTTGGGACTCAAACTGCCA
TTTCCTCCAACTTGCCCAGTACGGTTTGCCGCCCGTCGCTGGAAATTCGACTCCAGCATGCTTTTCGATTCGTCCTAGGTCAAAGCTAAATGAATTGAGT
ACTTTTATTCTCCTATTTGCGGTTGCCCGACAGAAATACAGTCTATCCACGATCTGGGCTAAATTTGAGATGATATCCTCAACGTATCAGTAGTTTATGT
TTGATCAAGACTTCCCACCTGCCACTGTTGTTGGATCCATGGCGTCGACAGAACCATCGTCACGCTTACGCCGCTTGCTTTCGTGTCTCTGAGTGGCGGA
AAGCTGTGGGccatctgcagctcgtttgttggatgaagaagtcgagTGCGGTTGGCCATTGGTCGCTTTGGGATTCGCCGAATTGCCACAGCTTTTCAGG
ATGCTGTCAAGTTTGGCCTTCGCCTCTAGAGCTTGTGCTGCCAATAGGAATTCGAATCACACACACAAGTCAGACTCGAGGCTGTATCCACGTGTACAAA
TGGCAAATTGCCTCACCCAACGATACACTGCGAGCAATCGGCCGTTCCCACGACGTCTCGTTTGTTGTCCGATTCCAGAAGTAGACGTCCCCACTGGCTG
AATCCCGTACTTCTTCCCAGTCCCTACAGCCAAAGTACAGTTGTCAGCTCTAATATCCTGAATATCAACCACCACAACCTGAAACATACTCGGCCAACTG
GTCtcccgtcgtcttcgactCCGTGGCCTTCACTTCTGTCGGTTGCTCGGAAGAGTTTCCAGGTCGCTCCCACGCCGTCTCGTTGGTCGACTACAACCAA
ACCACACCATTTAAATCACCGCTAACGCACTGAAGCACGCTGAACAACTGCCACCCACCTCGTTCCAAAAGTACACGTCTCCTGATGCAGGATCCACCAC
CTCCTTCCACAAGGCAGGTAAGGCGTTATATTCTGTCTCTTTCGGCTCCATCCTGTAGCTCTCAGtttgctgcgtcttctgcagatCCTGCGCTCGTCGA
AGCGCCACTGCATGGAGCGTGTTGTCTCTCACACGAGGGTCGAATTTATCGGCTGCTGACGGTTCTGTAGGCTGTGAACCGAGCACACGGCGTTGAGCTA
CTGAGGTGGTGGCATTGGCAGTCTGTTTCTGTCgtagttgctgctgctgcgtcagtTCTCGCTGGCTAGGACCACTGCCAGTAGACTGGAGGTACTTCAG
AGCTTGAGCACGGGCTTTTTGGGCAGCTAGTTCCTTCTTGAGGCGCTCTCCAGCGACCGCAGACTTTGGCGCCATTGCAGACAAT