Description :
From Genome Similarity Track
Location :
Scaffold_28:326082- 330065
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06894geranylgeranyl pyrophosphate synthetase
Sappa_CBS223.65SPRG_06895mannosyl-oligosaccharide glucosidase, putative
Sappa_CBS223.65SPRG_06896Hypothetical protein

Sequence
3983 bases(100 bases per row)
CGCTGGGATTTTCTGAAAGTGAAATCTCGCAGGAATCGAATTTTGTCCAGGATAGCGCGTCACGTCGGACCACGTCCCCGACTGCAACTGCCATGTAAGA
CTCGACACTCGTCGCGTCGTTGGATCCAAGGGACATCGATGTTCTCGTGTATTATGAGGCTCTTGGCTAGCATTCATTCTCTAGCCGACAACTCTTCGCT
ACGGGAGCTCCATCGCCGAGCACCACCGCCGTGACCATCAACTGCCGTCAATACAAAAGTGTCGCGAAGAGTCGTGGTGATGCACATGGCATTCCCGACT
GCCTCGGTGAGTATGGCTACGCGGGCTTTTACGGTCACACGCTGTTGCACTGGGCGGCCGTGACAGACACGCTGCAACTTCTCCTCGAGAAAGGCGCGAG
CCTCAACTTCCAGCACGCAGGCGTTGCAACCATAGCTTCTACTAGGGGCCTCAAGCGAGCCCATCGCGCTAAATTGCATCATCCACCAGTGTCGAGAGCC
CACAGGCGTCGAAGAGACAGGCGCGATGCGATGGCCGCGTTGTGGCACGGCGTGGGACAGGCTGTCGTTGGCAAATCAGACACCATGTCCATGACGTGGT
GTTTGGGCGTCAATTTGATGGTATCGCAACAAGCTCCAACAATTCAATCAACAGTGTGCTATCGACGAAGGCTCAATAGCGCTCGGCGAGGATGTTGGTG
ACGAGGGCGGTCCAGCCCGTGAACGGATGGCAGCGCTGGCCCTTCCCCGAGACGTCGTTGTACTGCTCGTGAAAGAAGCCCGTGCGCTCGTACTCGGCTG
CAATTGTGTCGACCACCGATGTTCGGAGCCGGGCGTACACGTCACCAAACGCCGCCCGTGTCGACGCGTCGGTCGCATGCGCCGCATAGAACGAAAAGCT
CTCGAGCGCGAGGTAGTTGAGGTTGATCCAGATGGCGCCGCGCCAGTACGGAGCGTCGCCCGGCGCGTTCGGGCGAGCGTAGTAGACGTCGGATGGCGAC
AGCGACCGGAGACCATGCGGTGTCAAGAGATGTGTCTCGAGCGTTGCAAGAAGCGGGCGCAGCTTGGGCGAGTCCACGGGGACGAGTTTGAGAAAGACGG
GGAAGAACGACACGTAGCCAATGTGCTCGACAAACTGCGGGCGCAACTAGACAACACCAATAGTGTCATCTCGAAAAAACAGATAAATATGTGTCGACGT
ACGGTTTTCGGCATAAAAATCTGCTTTTTGAGCAACCCGCCGGCGCCATCCCCGAGCGGGTACAAGAACCGTGGGTGCGACGCCGGACAGACGTCCGAGC
CGTCGCTTCGCTGCAGTTGCCGCGCCGACGCCGTTGCATCGATACCCCTAACCCCACAAGACGCGGTGAAGCCGAGACGACGACGATCCATAAAAGGACG
TACGCGCCGTCGACGGTCGCACACCGAATCACAATGTGGTCCTCAAAATGACCGTCCGCACTATGCAGGCCATAGTCGAGGTAGAGGCCGTTGGACCAAT
GGTGCGCGTCAAGTGCCTCCAAGTACGTTGCATGCAACGCCGAGAAGGTGCTGCCGTCGTGGCCGATGGCAGCCGCCACGTCGGCTAGCACGGACGCCGC
CTAATGCAATCCAACGATACCGTTAGTCACCGAGAACAGTAGTACCGTTAACGCAAGAAATACCTTGGCCATCCACGCCAGTAAATCCACATGGCGCTCG
TCGGTGGACGGCGACGACGCCCGCGGGTAGTCGTCCAAGCCGGACGCGAGCGTGTTGGGCATGAGGCGGCCGTCGTTGTGGCGGCCGCGCCATCGAAACG
TGTGCTTCACGTCGCCTGCCTGCGTTGTCTGGAACCACTGAAACCACGTGACGAGCTTGGGCCAATGCGCGAGGAGCCACGGACGCGCGCGCTCGAGGTG
CGCGAGCTTTTCGATCGCGAGGAGGAGCGTCGGCGGGTTCGCATGACTCGCATGCTGCACGAGAAACTCGGACGGCACGCGTTTTTGCGCCAAGTGCCCT
AGACACTCGACGTGTGAGCTTCAAGTGCGCGCATGCAAGCGCATCATATACCGCGAATCTGCTCGCGGGCCATGTAGCCTTCCTCGTCCATCGTGTGCAG
CCAATGGGAGAGAACTTCCATGCTGATGTCCATGTCAAAGTGCACAATGCCAAGCTGATGAAAACCCTCGTCCCAGAGAAAACCTCTGGGAAAAAACGAG
CGCGACGGAACCGCCGAGAAGAGCGGGCGTGGCGCCGTCTCCTCGATGCGTCCGTGGTCCTCGAGGTAGATGCTACAATATCCAATATGTCGTACACGAT
GGAACATACTGTCATGTCTACCTGCCGTAAAAGTAGCCAATGCCACCGATGAGGCTGCTGAACGCCGCTTCGGCCAGCGCAATGTGCTTGGCCGAGCTCG
ATTTCGCCGCGAGGCCAAACGTGTCTTCAAATTGACGTCCAAACGTTGCGCTATAGTCGGCAATGACATCATTGTACACAACGACGGGCGTCGACTGCAG
CACATTCGTGTCGTCGTCGGTCGCTTCGTTGTAGACGATGTGCAGCGCAACGTCCGAGGCGCGGCGAGGGTCGTAGCGCAGTTGCAAGACGACGATCGAG
CTCTCGTCGTCGACGTCGTTGGGCAAGACGATCGCCGCGTCCGTGCTTCCGGGCGTCCGTGCCGCCAGTTGCACGAGACGGTCCTTGACGTTGACGACGT
TGACGCCGGCGTCACCCCAAAAGTGCAAACTCGGCACATCGCCTGTCACATGCGCCTGAACGCGCGTCGCAAAGTTAAAGGTTGCGTCTATTGCATGCTC
GGCGCGGACACTGAGCTCGATGCACGTCACGTCGCTCGATGCCATGGGCTCGACGCATGACGACGGCTCGTCGATGGTCCACTGCAGGTGCTGGAGCACC
TCGTCGCGGCAGGCGTGGCCCATCTGGTCGTCGCCGCAGCCCACGTCGATGTAGAAGAAGAGCGACGCGAGCTCCGGAAGGCCCTTCTCAGCGTACAGAG
GCGAGACAGTGATGCGCGAAGCCCACGAATGCGTCGCGACGCTGCCGTCGTGTGCCGGTGGCTTGAGGAACGTCGTCTCGATGGCCATGCGGTTGAGCCG
GTCGCGGATCGTCTGCTGGCCGAACGATCGCCCATTGTGCTTGGTCCAGCCGTACGACTCGAGCCGGTCGCGCTCCGAACACTCGTGCTTGAGCTGGCTC
ACGTCTTCATTGGCCGACGTCCAGAGAAGGCCTGCGCTGACATGCGTCGGGTGCGTCCGCGATCGGACGCCAAAGTAGAGACCCGAGTGGTAGGTGCCCC
AGCGCAGGCTGTCGTCGCCCGCGCACGACGCGGTGATGGCCGCAGCAACGGCCAACGCCACCGTCCACGTCATCGCCTTATCGAGTTGCCTAATGCAAAG
GAAACCAAACAGTATTACACTATTTCAGATGAAGATCGCCAATCGACGTTATATAGTATATGATACTTGACCATACTCAAACGACTACATGTACTGACCT
GACACCTAGTACAGCGGCCGCACGCATCACACGCACGGTGTCGAACTGCAGCTACTGCTTTGTTGATTGACGCAAAGAATGTCGTATCTATCTATCTATC
TATCTATCTATCTAACAACGTTCAAATGACCCTCGAGTGGCCGTGCACGAAGCCTCCACGACGGCGCCGGGTGTCGAAGCACTCATCGTGGGCAGTCGCA
CGCGGCCTGCCTCGTCTTCTGGGGTCAGAGAATAGACATACTAGGGTAGTACCTATGTGACCCGCTCGACGCTCGAGTTTTATTATTGAACGCGATGGCT
CGGTAGACGACGGTGATTGGCAAAGGTGTCGTCTAGCTACAGTACGTGTTCGGGCGCGAGCGTTGGCGTGATTCAAATGCCGGTGGCCGACTCGGAGGCG
CTGCGTCCAAACGTTGCAGGCTGGGCCCAGCCGGGCTTTTCACTCCCGGAAGAGCGCGGGAGGTCCGTCTCGGTCGGACGGGC