Description :
From Genome Similarity Track
Location :
Scaffold_25:32600- 35444
Transcript NameFunction/comments
Phyra_77484AlNc14C38G3312
Phyra_77485conserved unknown protein

Sequence
2844 bases(100 bases per row)
AACAAGATGATCACCGCGTCCGTGGGCGTGGACTCGAGTCTGCTGCTGGAGCCTGCGCGCGAGCTACAGTTCCCGCTGCCGGACGTCACGTCGGGGCACC
GTCCGCGCTGCTGCCTCACGCTCACCAACTTGTCGCCGCTCAACGACGTGTTGTTCCGCGTACGGACCCGCAACCCGGACGCGTTCACGGTGTGTCCGAC
CCACGGGCTGCTAGCGCCAGGCACGAGCTCCCAAGTGGTCATGACTGCAACTGCGCGGACCTGCGAGCGTCTGGGTGCGATGGACCCGCGGGATTTGATG
ACCCGTCAGTCTTCCGAGCTCTTCGTCGTGCAGAGTATGGAGCGAGAGAAAGAGGTGCAAACCATGCAACCGCTGGACCCGGACTCCAGCTCATCGCTGC
GGGCTTTCTGGAAGCAGATGCCGAGAGACTGCGTCACGGAGAACAAGCTGGTGTGTCGGTTCACTGCTGGTATCCCTGCGCTGGCGACCAAAGTCACACA
GGACCCCAATATGTTCTCGCGGAGTTTGAGCAACACGAGTATGAACTCGCAGGAGTACCGGTCCGGTCGCGGTGAAAACAGGAGCTTGAGTATGAGTGCG
CACGAGTTCCGGTCGAGTCGCAGTGGAAGCAACAGCGAGTTTAGCAGACTCAATCGGTCTTTGAGCAACCAGCTAACGCCGCCGCCGGAGATGCACAGAA
ATGAACGCTGGAGCCGAAATCAATCGTTTGGTAGTGACGCCAGCTTCCACACCACAATTGAGCCCCCTATTGTGAACCGAAGGTCGGAGGCAAGAATGTC
GACTTCGTCTAACTGGGCTGCGTCTAGAACTCCCACGACGAGGCTACGAGACAGCGCGCTAACTAGCATCAGTGTGAGCGACGGATCTGTCAGTGACACT
ATGCTGTCCGCGCAGACTTCCTTTTCCACGGACGCGGCAACGGAGGAACAGACGCACGAGCTCGGTCCACTTCAGTACCACATTCAGCCTAGTGACGTGC
TTTCGTTCAATCTCAAGCGTGCACCACGCTTCTGGGGTCAGACTTCGCTCTTCGTGGTGAACTCTAGCCAACACGACTGTCTCGCTTTTAAGGTGCGCAC
GTCTAACCAATCGGGCTACGTGGTGAAGCCCAGCCGAGGGCTTGTATCGACTACGAATGCGCAGGAAGTGATCGTGTCGCTGTGTGCACCGCGCGATGAA
AACAGTTTTGATCCCGCTAAGCGCGAGGCAAAAGATGGCTTTATGATTGAAGTCGCCAACATCTCGCGGGACAAGTACGAAGGTTTGATGAGACTGGACG
AGCGAAAACGCACCCGCGAAATGAGCTCTCTGTGGTCCCTTATGCCTCGAAGTGATCGTCGGTCGACAATGCTTTCTGTGGAGCTGAAGACTGGAGGAAG
CGATTGCGGTAGTGGCACCTGCGACAGCTCTGACAGTGGAAACTCGGACGCTCGGAGCACTGTCAACCGGAGTTCACCTGAAAAGTCTCGACAAAGTTTG
CACTCGGTCGTGCGGGGCATGAAACAACTATCTACCTCCTCTTCAACGGATGAGTCGCCTGAGAGCGTCGCAGAGGAGAAGCCGGGATCCGCGTACGATT
CGGACGAGTCGGCGTTCACTGTCGCTCCGAGTGTCGCGCTCTCTGAGGTTGGCAAGGATGAATCTGGCAGTGATGCGGACGTGGCCTTCAGCTCGGCAGC
AAAAAGCCTGCCACGAGATCCCGCTGTGATTGTCGTCTCAGCCGACAGGATGGACACCGTCGACTTTTCCAACCCGAAGCTGTCCTTCTTTATTTAGTTG
TTACGCCGATGGGGGAGCCGCGTCGAGTGTTGAAGGCTTGAAGCCTTAAGTCTTTGCTTTCATGACCACTTCATCCCAAGGACTAGGCTATCAAAAATGT
AGATTCGTGAAGTTTCAAAGGTTGTTTCTGCTTATTTGTAGAAAAGGTCGGTTATGCGAGTCCATTGACGGTGGCTCAGCCCCGTGTGATCTAGCTACTC
TCTACTTGGTCACGATGTTCTCCAGGCTCTCGAGAACCTTGACAGTCGAAGACGTACCCAGCATGTTGATGATGCTAGGTGGGATGTAGCCGGCCAGGTC
GGCGTGTGCGAGGAGGGTCACGATGCAGTACACCTTGCCGTCCTCCTCCTTGAACTCCTCAATGAGATAGCCCGATATGTAGTTGTGGGCGCGCACGTAG
CCTTCCAGAGGCGCGACGTCCGCGACGTTGACAGAGCGCGTGGCAATGGCGACTCGTCCGTCTTCGAGTGTCGTGGCGTACGTGACCACGACGAACTCGC
GGCCGTAGATTGGGAACTGACCCTTGCTAGTGATCTGGCGGAAGGCCAAGTGGTTGGACTCGCCGATGTCGCGCAGCGTCACGATGCCCTCCATCATCTC
GTCCAGCTCCAGCGTGCGGTTCGGGTCCAGCAGCACCTGCTCGATGACGCGCTTGTCGGCATCGATGCGGCGCGCGGCGCGGAACGGGCACCAGTCGCAG
TCCTCGACGGCTCCGCGCCAGATCTGCACGCCCTCGGCGTCGTCCACGAGCTCCCACGTCGTGACCTTGTCGTCACCTGAGTGGCGGTCGAGCAGAATCT
GGATGTTCTCCTTGCCGTAGGCCTCAAAGTCCACATCGTCGGCTGTGGGGTACGCGGGCTCCTCAGGCTTGATCTGCTCCTCCGCCGCCGGCGTTTCTCC
GTACCCGAACAGGTAGTTCATACTAACTTGGTGCAAATGAAGAGGAAGGTGGCGCTGAAGAGGGGGTTTCTCGACTGACTCCGCCCACGATGGGAGCCGC
TTGACTGCTTTGACTGTTTCTGTTGCGGGGTACAGAGCGAAGCG