Description :
From Genome Similarity Track
Location :
Scaffold_1392:3260- 4470
Sequence
1210 bases(100 bases per row)
gcttggacgaagcggagggagtgagcacgctAGGCTTAACCGAGCGAGAACACTTGACCACTTGAGGGGTAGAAGGAAGATTCGAAAGTGATTGATTGAN
CGATGGAGCGTAATCAACGTGGGTTCGCAttggaccggttcgggctaaccggttcacggttaagaaccgctatcaaaccgaTTACCCTTAATAGATCTCA
CGCAAGGAACATCGTGGAAGATCTTTTTCGTGTTCCTCCGTGGTCTACGCGGTGATGGCCGTGACTTCAAGTTCAAGCCCTTTTCAAAGCAAAACTTCGC
AATTGCAGGTCGCCGTGGAGCCCGTGTTCTCGATGAagtggagctgttcgacggACTGTACTTGTGTGCAGCATACATTCACTCGTTCGTCGGTCACGCG
TTCGCACTCCGGGTTCAAGGAGATCAGCGCCTCGTAGTTGATCAAGACCAAGTCATACTTCCGCAGGCAGCGACTTGGATTAATTTCGTCGCTTTCGTTC
GTCCGTTCATCGTGTATCCATAGAGGTAGATGATAGGAGTCGGTAGGGATTTCAGCGGGCTTGCCTTATCGATAATGAACCTTTCCTAGCAAAATATGTT
TCGTGCATGGTATACTATTTCTTGTGCCTGTACGAATTCGGTACTAGACCAGGGAAACATCAGTGAGGAAAAACCTTTCAGCGAACAAACTATAAACTCA
GTGGGGAAAAAATAAAAATACGCATTATACATAGGCACACTTCATGCATTAGTGATTTACTCGTATACTATACGGAATGACCTGTTTGAGCTGTGAGGCT
TTGCATCCTGGCCTTGGTCCTTAGTTCTCTAAACTGATGTTTGTCTAAACCTTTTGTTAAAATGTCAGCCACTATTTCTTTGGTGTTGCAGTAGACAACG
TTAAACTCGTGTCGCTCTACCTTCTCCTGCACAAAAAAATAGCGCAAATATATGTGCTTTGACCGCCCGTGCAATTCCGAATTTGTAGCTAATTTTGATA
CAGCTCTGGTTGTCTTCATGGATAATGTTGGGCTTTGTGGTTGTGAAACCTAACTCTTGGATAGGGAGTTTGAGAAATAGCATCTCTTGCATGCATGTGG
TATAAGCCGATGTATTCAGCCTCTGTTGTAGAGAGAGCCACGCAGGCAAACGTCGGCGATTGACAAGCGACCAAACGGTGCACCGATGGATCTTAGCATC
GGACTAAAGA