Description :
From Genome Similarity Track
Location :
Scaffold_2496:326- 2935
Sequence
2609 bases(100 bases per row)
GCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGTGTACCCTGCGCTGTACTTGTGAA
GGTAGTTGGCCAAACCCAACAACTTATGAAGATCCTTCTGGGATCGGGGCGTTGGCCATGTTGCGATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGTC
CACGCTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTTGCTCGCATTACGTCCAGC
ACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTAC
GCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGATCCACTCCCAAAGCATTCCGCTTGG
AGTGCTTGCCGCGGTGAGCGGGATGTCACTCTCCCGCATTAGGATCTGGTAGTATCCGTCTACTAAATTCAGCGCACTGTACAGTACGCTCCCGGTCATG
TTGTTCAACAACACATCCTTTCGTGGGATTGCTGTTTGGGCCGGCACCGTCGCGTTGTTCAGCTTGTTGTAAGCATGAGCTAGATGCCACTTTCCGTTCG
GCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGTTTTCGACTCGGGCACCATGACTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCA
CTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACATTGTGCCAGGCACGAGATCAATCTCATGCCATACGCCTCGATCCGGTGGGAGTTGGGTC
GGTGGTGTTTGTTCACCACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGATTCTTAAGGATCTCAGAACCCAAGCGCGCCTGACGCTG
TTTGTTTAGGTCTTCCAGGACGTTCTCATCCAAGACCGAGGAGGCATTCAGCTCCTCCCGAGTGGTCTCAGGTCTCATGAGCAACATCGCAGCAATCTCT
CCAGCCTTGAGGTTGGCCAGGAAAGACTCGACCGTCATTTCCTCGAGGTTCAGTATCTTTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAAATGCCT
TGACGGGTAAACCCGTCTCGCTATCGAAGATGTGATAGCACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGAC
GTCGATCAGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTC
GTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGA
CCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCT
GAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTG
GGCGCGGCCACCATCAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGC
CCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCCAG
GGTTCGTGCTCCTCGAGCCAGGGCATGCCCAGGATTATATCGTATGGATCCATGTCGAGAACAGCGAACTGTTCGAGGTTGTCAAAGTCTTCAAACTTGA
CGGCCAGATCCACTTGGACGTTGGGAACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCGGA
CAACTTGTTGCTATTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAATCGATCAAGATTCTACAGGGATGATCGTATCCCCGTACA
CATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTACGAAGACTCTCAGGGGCTACGTCCCCGTGGTACACGCCACGCGTGCACC
CATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACAGGTTCCCGGCGTCCCCCTGCCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTG
AGGACGGGCTTGGGGAAAGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCGCAGCCGAAGCAGCGGATGTCACGCT
GTTTGGCGGACCCGAGCTCCATGAGAACTGGTCCGTTGGGGCTCGTTCGAACGGGAGTCGACAAGGAACTCCCAGGCCACGCTTAGGCCGGCGTATGCGC
CTGGCGATG