Description :
From Genome Similarity Track
Location :
Scaffold_397:326- 2524
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_397-snap-gene-0.9Myosin

Sequence
2198 bases(100 bases per row)
ACGTCGGCGAGTACGGTATTGAAGACATGATCACACTCAACTACTTGCACGAAGCCGCGATCCTGTTCAACGTCAAGACGCGTTTCCTGCAGAAGCTCCC
ATACACGTACACGGGCGACATTTGTATCGCCGTGAACCCGTACCAGTGGCTCCCAGATCTCTATGCGGACGAGCAGCACCTGCGCTATTTGAACCAACCA
AAGGAAGAGCTCCCGCCGCACGTGTACGCGACGTCGGTGGCTTCCTACGACAACATGCGTCGCACGGAGCGCAACCAGTCGATCTTGGTGTCGGGAGAGT
CTGGTGCCGGTAAGACCGAGACCACGAAGATCTTAATGAACCACTTGGCGACTATTGCCGGCGGTTTGAACAACTCGACGATCAAGAAGATTATCGAAGT
TAACCCTTTGCTTGAGTCTTTTGGTAACGCAAAGACCGTGCGTAATGACAACAGTTCGCGTTTCGGCAAGTTCACGCAGCTGCAGTTTGACCGCGAAGGC
ACGCTGGTCGGCGCCAAGTGCCGCACATACCTGTTGGAAAAGACGCGTGTAATCAACCACGAAGAACCAGAGCGAAACTACCACATCTTTTATCAGGTAA
GAGTTTTCCACGGTGTTGATTCGGGGCATGCTTTCGTTGTGATGTGTGTATATACGTATATTGATCATTGCCTTGTATAATGTGTCCACCAACTTCTACA
GATCTTGGAAGGTGACTCCGCTCAGGAACTGCTCTTGGACTCGTCGAAGACATATGCGTACACGGGCAACAACAACGCGGTGAAGATCGAAGGCATGTCG
GATGCCAAGCACTTTGAGAAGACGCGCGTTGCGCTGGAGCTCATTGGGCTCACGCCAAACGAGCAAAAGCCACTTTTCGAGGTCTTGGCTGGCGTGCTCC
AGCTCGGTGAAGTCTCGCTGCTGTCCAACCCAGCGAATGACGAAGAATCGCTGATCGCGGAGGGTGATGCGGGCGCGCTCGCGTGTGTTCAGCTTTTGGG
CGTGACGTGGGAAGCGATTGAGAAGGCGCTCTGCTCGCGCACGATGCGTGCCGTGAACGATGTCTACAGCGTGCCATTGCGCAAGGAGCAGGCCATGGAT
TGCCGTGACGCGCTTGCGAAAGCTATTTATTCGAACGTGTTCGACTGGCTCGTGTCGTCGATCAACCACTCGCTCTCTGACGACAGCAACATGTTCAACC
ACGTCGGTGTGCTCGATATTTTCGGTTTCGAGCACTTCAAGCACAACTCGTTTGAACAATTCTGCATCAACTATGCCAACGAAAAACTGCAGCAGAAGTT
CACGCAAGATGTGTTCAAGACCGTGCAGATCGAGTATGAGGAAGAAGGCATCACGTGGAACCACATCGAGTACGCCGATAACCAGGACGTGCTGACTGTG
ATTGAGTCGAAGATGGGTATCATCTCGCTCTTGAACGAAGAGCTGATGCGTCCAAAGGGTAACGAGGAGTCGTTCATGTCGAAGGTGGCGTCGCTGCACA
AGGAAGACATGGCGCACGTCATTGAGTTCCCAAGAACTTCGCGCACGGAGTTTTTGATCAAGCACTACGCCGCGCCTGTCATGTACGACTCGGTCGGTTT
CTTGGAGAAGCACAAGGATGCCTTGCTCCCAGACTTGTCGGAATTGATGCGTAGCTCTTCGAAGCCATTCATCTCGGCGCTGTTTGAGCCAAAGCCGGCG
CCAAAGGTCGTCGCGACGGACCCGAATGCTCGCCGCAAGCGTGGTGGCGGTGGCGCGTTGACTCTGTCCACTGTCGGAACACAGTTCAAGGAGAGTTTGG
CGGAGTTGATGACCACGATTCAAGCCACGAAGGTGCACTACGTGCGATGCATCAAGCCGAACTCGATCAAGAGTTCTACGACAATGGACCAAGCGATGGT
TGTCTCTCAGCTGCGATGCGCTGGTGTGATTGAAGCGATTCGTATTTCCCGCGCTGCGTACCCGAACCGTCTGCAGCACACGGAGATCCTGGACAAGTTC
TGGCTGTTTGTTCCTCGTCAGGGAGAAACCGCGAGCGAGAAATGCCAGTTGCTGATGGAGAAGCTCAAGTTGACGACTCCAGAGCAGTACCAAATGGGTA
AGACTCGTGTGTATTTCCAGCTCGGCGTACTTGAAGAGCTCGAGGACCGTCGTAAGAAGTTCTTGGACGCCAAGGCGACGTACCTCCAGGGTGTGATG