Description :
From Genome Similarity Track
Location :
Scaffold_2458:326- 2165
Transcript NameFunction/comments
Phyag_g12494hypothetical protein

Sequence
1839 bases(100 bases per row)
AGACGTACTATGACATCTTGGACAAGCATTACAACGACTTTGAAAGCGAAACAAGGGCTCTGTTGGAAAATGAGTTCAAGGAGCTTCATGGAGCCGCATT
TCTGACTGTGGAACACGATTTGTGCACGAACAAGTCGAAGAATACTATTGTGGGTGCTTCTTGCGGGTTTATAGATGACGAGTGGAAGCCTCGTAAACtg
gcgcttcttgcccaGGCTAAGAATGACGGTCACGACTCAGCGGACGTTGCTCATTTGTTGGACGACGAACTGATGCAGCGGTACGGATTGGATGTGGAGA
AAATGGCGCGCTTTACAATATCGGATACAGCTCCGGCCGCTCGCAAAATTTCTAAGCAGTTCGACACTACTTTGCAGACAGATTGTGCAATGCATGCACT
TAATTTGTGTATCGGTTATGGAGTCGGCTTAAAAGAGAATACGAGGAACCAGTACGTACAAGACCCACTCACCAAAGAGTTCGCAAAGAAAAAGATAGTT
ATAACTCAAGGAGGTGCTTTTCCTGAAGGTGGCTCTCTCATCCGGAAACTGCGATCGCTAAACAATTTTTTTGCTTCAAACCGATCTCCCGAACGCATTG
CCCGCCTCAAAGAAGTACAAGTTTTCTACAAGTTGCCCCAGCTCTCGACTCTAATTGACATCGACGTGCGTGTAGCTTCAACGATCAAATTGTTCAGACG
CTCAATAATCAACTATGCTGCCTTCAATGCTTTCTTCCAGAGGGCGGACCTAACGGAGAGTGAGAAGCAAGTGTTCACGTGTATAACAACCGCTGAATTG
GAGTTGGTGATACAAATGGAGGCAGTGATGCAGTGGATTGCAGACCTAGCCCTTGTCGAGTCACAGTCTGCTACTATGATATCGTCAACGATGTACGTGT
TGCTGCGAGTTGCATCCTCCAGGATCAATTCTTACAAATTTATGGCGTATTCACTGAACGGAAATCGCAACACAGACACAAACGAGACGAGCTTTGCCCG
ACAGCGACTCACTTTGTCGGACTTGAGTACATTGGCGCAACGATGCATCACGCGTACACTACACCAGCTTGCATAGCGGCTTCCTGCGCCGTCCGTGTCG
ATGGGTATGGCTCTACTCTTGGACCCACGCACTAAACGAGCTGCTAAACACTATCTACGCATTCCCGACACTTCAGAGGATGCAACCGATCATATTTTGG
AAGAGACAAAAGCGCTAATGCGCGTAGAACATCGCGTGTTTTTCAAGGCCCTCCACGCGAACGAGAACTGCGAGAATGAAAGAACGTCTTCTGCATCGAG
TTCGCCTCGTGGAGAGTGTGATAGCAGTTCTGACACGGAGCTAGACTTGCTTTATGGCGAAGAAGTCACTCAACCTGATGACTCGACATCCGTTGACACA
ACGCTAAACGCGAAGGTGGACGCCGTACTAGATCAGTGGCTAAACTTTCGAATCGAGTGGGAGGAAGCGGTAAGAAGCCAATACCCAGACAAGACACAGA
GAGAACGAGAACAAGTGATTGCCAAGCTTACAatgcgcaacaagaagcaagGGAACGTCCGAGTGTGgaacgtcgagcagctttgTCAGTAGATCGACAT
CTGTCGCTGGTTCTCAGAGTATGGGCAAGCTCAGTTTCCATCAGTTGCAAAGCTTGCCCGCATTTGGCTGGGGCGTACGTGTTCCACGGCGTTCCAAGAA
CGTGTGTTCTCGACCGGTACATTAGTCATGAGTTTGCTTCGGACTCGCACAGACAATGAGcgcgctcagcagcagctgattCTTCGTCATAACCGCGAAG
ATCTTCAGCGCATGGACGAAAGCAAGCGCCGAATATGGT