Description :
From Genome Similarity Track
Location :
Scaffold_3456:326- 1708
Sequence
1382 bases(100 bases per row)
CAGACGGTTGCAAGATGATGTTGGACGATTGGAGAGCACGGATCCACGGCGAGTGTACAATTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAG
TGTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCA
GCCGAGCCTAGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGAACCTCATTTGCACCATA
ACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACT
GGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCT
AGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAGCTACTAAGGCAAGGGATCACACCCGCAAGGCAACCCTACGGC
CAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCA
CCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGG
TGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTT
GCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGGTTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCC
AGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAGTGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGA
AGAGAGGTGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAA
AACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAA
GAAGACGAAAACGAGTACGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGC