Description :
From Genome Similarity Track
Location :
Scaffold_3276:326- 1569
Transcript NameFunction/comments
Phypl_g15736hypothetical protein PHYSODRAFT_510491

Sequence
1243 bases(100 bases per row)
CCGTACATTTCCTCGGTACCTCCACCGaagtcttcttcgacaactGCAACACCTTCTTCTCTTAGGTTTTCAGCACGGTCGCCAACTGGATCACCTGATA
GACTAGAGAAAGGAGCGACCTCCTCCTTCCCTTCCTCGCTCCCCCATCATTGTCGCGCAGCCGGTGGCGGAGTCCCTCCTGGGGCAGCTCCCGTCACCTT
CGGCACCAACTCTCGCAGGGACAGCAGTGTAGGGCAGTCCACAACCATGTGCCCAGTCTCGTGGCAAAAGAAACATCCGAGCGGTTGACGGACGACCGGT
CCGTTCGAAGTCCTTCCGTTCTCGTTAGTGGAAAACCCTTCGCACTCCGTCAGTATGTGCCCCATCTGGCCACACTGATGACACGACATCGTTTGACGCT
TGCACGTAGCACGGTTATGACCTCGATAGCCGCAACGACCACAAACTGGAACGCCTTCTTGCGTACGCGCATCGCCTTCCATCCGAATGCCTCGGAAGAA
CCGACCGTTCCCTTGCTGTTCACGACTGTTACCAGGAGGTGGAGACAGACCGTTGATTGTCGACACCATCGGAGCACGGTTCCGCGGCGACCTAGGAGCC
TGGTACTGACTCCGAGTCATAtcctgctgccactgctgctgctgctgcatgaacaactgcaactgctgcgTCAAGGCATCGACCGACGctctccttctgc
ttcacAGGACCCTCGTCTgagaactcgtcgtcctcctcgacggGTCGGTACATGTCCTTGAACATGAGCCACTCACAGGCTTCAGGAATGTCACTCGCCG
GACTCGAATCAAGCGTAGCCAATATGCGCTTGTTCCTCAATCCCCGACGGAACAACTGGTAACGCATCTGCGGGTTGGGATAGTTGAGAGAGTCACACAG
TTCCGAGACTCGATCTCACCATTCTTCCACGGATTCACCCTTTCCACGCTTGGTGGTATGCAACCGTTCCCAAAGCTCATCGGCAGTCCGACTGAGGAAT
TGGTTGTGGAACCGTATCTTCAGCGTAGCAAACGTCCTAATGCTCGGGTTTCCCCACCAGCGCTCCGCTTCCCGCCCCTTGAGCTTCTGACGGAACACCA
GCAATCGTGACCGGTCCGGGAGCCCCTCTGTATGGGTTTCGAACATCTCCCAGAAATCACGAGCCTTCTCGACCGTGGCGGTGTCCGAGTAAAACATCGG
CAGCACCTTGACCGCATTCGACACCAGGTTCGACAAGCCATAC