Description :
From Genome Similarity Track
Location :
Scaffold_6:3259930- 3268107
Transcript NameFunction/comments
Phyin_T30-4PITG_04841Putative uncharacterized protein
Phyin_T30-4PITG_04842Putative uncharacterized protein
Phyin_T30-4PITG_0484360S ribosomal protein L13

Sequence
8177 bases(100 bases per row)
CCCAATCTCCAGAAGTCCCGTGACACCCACATAACTCAAGCACGTGTAGTACGGAGGCAAGTCATTCTCCTGCATCCACTGAGCCACATCGAGACCGATA
TCTTCCTGTCGGTCGAACAAATTCAATCGCAAGACGCCTCGTGAGAGAAAAACCCGCAACGGAAGCTCGAAGCTTTGCATCTAAATGAAACCCAAAGCCT
ACCGTCAGTATCTCATCCGCCGCAAGTTACCATCAGCGATGCGTACCTTCATATCTTTGACAGCACTGAAAGTCATGGACTCGTAGACCAACGTATCGAT
CTCTCCGTCCTCTCCCAGCTCATACAAAGCGAAGGATATTCGTCTCGGCGAGTACGTGGGGCTGCCAGGATACCAGAAAACCCGGTACGGTACCAGCTGC
ACACTGTTCACCAGGCAGTTTTCCCACAACGTGTAGTCCAGATAATCTGTCGTCTTGTACCCCCACGTCGAGGCACTGTACATTCAATACCACACACCAG
TCAGCCTCTCCACACCGACACTTTATCCTTATGTCTGCACTCGGACCTGCTCCAGTAACACGGTTGTCCTCTAGCACAGCCACAGTCCAGCTGGAGTCTC
TTGGCGATAGCCTCAAAGGCCAAAGGATCGTCGACCACTACCGTATTGGACAGCACAGACACCCCAACGCCACAGTTCGACCTCGTCAACGTGTTTTCTG
CTGACTCATTCGAGTGATCCACGGACGAACACTCTGCAAAAGATGCACGTGTTAAGAATTAAATACACTATGGAATTATTATTTTTTAGGTTTCTCGTAC
CTCTTACTCGTCGCAGCATCGACAGTTCCTCGCTCACGGGGTGATACGTCAGCAGCGTCAAGCGTTTCCAGTCCGCAGAACTTCGTTCGCTGCAGTCAAT
CGCATACAGAGCCACACGCTGCGCTAGAACTCGCCAGGAATCTGTGTTCAGTAGGAAAACTAGGTCAGCTTAATGGGCATAACTTTGAAGAGGCGGAACG
ACGCACCACGCTGGACGATGCTGTCTCGCAAGTGGCGGCTCACAGTCTCGAGATGCAGTAGCGTCGTATGGTCTGCAAACTGCAGCGTCGCCGCCAGTAG
ATCACTCGGCAACTCGGTCAGTCCCATGCGTGTAGCTTCTAAGCAACAAAGTTGAACTTGCACATCCAACTACAGTGGTGTCTATTTACGGAATCTGTGG
GAAATAGTAACCTACTAGATCAAATACAATTTTGATGCCTTTGTGAAACGTTTTACTCTTTAAATTTTATAAACCTACTGTATTGACTACATTCCATCTT
TCATTACAATGAGATAAACTCCTGATCGTCTTACAAGGCTCAAGTCGATTGTATTCGCCTGTACAATGCCATGTCTAGTCTTCCCAGCGCTTCAGCGCCT
GGCGGAGCATGCGTTGGAACTGTGAGGTGGCAGCACGCTCCTTCTGGATCTCGACTCGAAGACGCTTCATCTCGCCCACCGCCTTGTACTTCTGCGTCGA
CTCGCCCCCCGCTCTCAGTGCTCCAAAGCTCTTTCGTACACTTTGCATCGATACTTGCACTGGTTTCTTCACAACAGTGCAGTGGCGCTTAGTAGAATCC
AACAGCTGCTTCGGAGTTGACGTGTGCACAGCATCCACAAGACTCGAGACACTCGATCCGAAGCCTCGCCAGTCCGCTGGATAGTAGATTGTCATGTCGC
TCAGCGTCTCGAAGAACGTGTCGTAAATTTCCTCGAAGATCTTCCTCCAGGGCAATAAGACGTCTGCCTCTTGTGGCGTCACCTGTTCCGTCTTGCTATC
TTGACTCAATCCTTCATGGATCGGAAGTAACAAACAGTAAATCCTCTTCTTCAGCTCGTACGTCGACACCGCAGAGGCCGCCGGATACGCTACAAACAGT
CGGTCGATAAACTCCTCCACCTTCTTAAAGTACACGTCACAGATTTGATCACGATGCACAGGGGACGTCTCGACCACGATGCGAGTAGCTTCAAGCGCTG
TTAGCACAGACCGGATCTCAAGTTGCCGCTCCTGCGAGTTCCAACCACGTGGGGGGTCCACAACAGCGAACTGAAGCTCTGGCGGCGGGTACACGAGGTC
CATGACACCGGACGATAAAACATCTTGCCGCACACGTGGGAAGACAGCGCAGATGTTACTCTGGATGCCAATGGACGACTCAAAGCGGTACATCATCGCC
TTGACACTCCCTTCTAGCAGTTCCTTCAAGCCGACGCTCTTGAGGTGACGTACAGGGGGCGACAACTCGGCGATCTTCTTCAGCATTCGGCCGAACTGTA
CAGGAAGTTGAGCCCCTGCATCGACGAGCTCAACACCGACGTGAGCCAACTGCGTTGAGAATCGACGCTGCACTCGTTCGACACAGCTCTCAAGCGTATT
GAAGAGTTCTGCTCGTGTGGTCATGATGTCTGCTGAAGCGAACCCCACAGCCAGCACAGACACGCGACACCCTCTGTTCAGTAACGACAGCAGCTCTCCA
AGTTGCTGCTCCCAGACACTGCTCTTCCCAGCTTGCTGTAGTACACTCAGATCGACCGGTAGTAAGATGGCTGACGTAGCAGCGAGCTTGTGTTGCTGCA
TCTCCCGCGAATTCCGCTGACCGAACGTTGAATCCAGATACCGACTGCACACAGCGACACCGGTACTTGACTGGTAGCTGCGTTGACAGTCGTGCTCAGG
TGTAGAAACATCCTGCGCTCCAGCTCGAACTGCGCACCACAATCCAAATGACGATGACGCTCCATCCAGCAGATCTGCGATTACCAATTTCCACGCGATA
GACGGCACTCCAAGGTTCTGTCTACGAAGAGGAGTTCCAGCCAGTGCCAGCATGTCTTCAGACTGCCACAGCGCCAAGAGTTCTTCGTTCGACGGCGTCA
CGGGCTCATCAGCTATCGGTAATTGCTTCACTCGCTTCGTGCCGATTGCTGATGCTCCATTAGCACCTCGGAAAAGCCACTGCATACTGTCTCTCGCCTT
TTGATGAGGCTGATCAAGTCGAAGCTTCGACGCTAGTGACACTGGCCCAGGACCGTCACGTGACACTTGCACGTATATCTTCCACAGATGCAGTCTCAGC
TTCAGCACAGCAAGTCGCTGCTTCTCAATGCGACGCACTCTCTTCCGTTCAGCTCGTTCCTTTGCCAATTGAACTTGTCGTTGCGCCTCCAGTGCAGCTT
CACGCGCTTGACGTGCTTGCTCCTCTGCCAGCTCCTGCTGACGACGTCGTTCTCGCTCTTCTGCTGCTTTGCGACGAATTTCTTCTTGTCGCTTTGCCTC
CTGTCCACGTCGTTCGTCCTCCGCTGCCTTTATCCTCAGAGCCTCCGCTTGTTGCAGAGCAGCAAGTCGTTGTCGCTCTGCTTCACGAGCTGCTGCTTCA
GCCTCTCTGCGCTGTTCTTCCAGCTCCCGCTGCTTCTTTTGTTCTCGTAACTGCGCTTCCAGAGCTTCTTGCTGCTGCTTCGCTTCGGCCGCTTCTTTTT
CCGCTTTAACTCGGGCAATCGCTTCCTGTTTCTTCTGGTCTTCAAGTTGAGCAGCCTGACTAGCAACAGCCTTCTCCGCATGCTCACGTCGAGTCTTCTC
CTCTTTCGCTCGTTCCAGCTCTCGCATTCGCTCCAGCATCGCTTGTTTCTTCTGCTCAAGCTCCATCTTTCTCTGAGCAATGGCACTAAGCTCATGCCTT
TTCTGATCGCTTACTCCCGCTTGGTGTTGAGCTTGAGTACTCACTGGAGCTGTCATGGACGCTCCGTCGTTATAATCAACGAAGTAAGAGTAGTCGTCCT
CATACGCTGGTCTCTCTGGGTACAATCTGGCCTGCTCCTCCCGTTCAGCGTCTTGAATCAACTTGCTAAGAGCTGGATACTCATCTCGAGCATATTCCGT
CACGCCGCGACAGATGTCTCGCCGTAGATAGTTGCTATACACACACAAGGGGATAGAAGTAAGCAACAACTCGACCTGCAAAAAAATCAGTAGTGCATAC
CCTTGCTTCATGCCAACGTAAATCTTGGAGCTGCGAACCTTCAACGGCGTATTGCTCCGTCGTAGCTGGGCATCTGCACCAAAAGCCAATATACAAGTGT
CAGCTCCATGTGACGAACCACCAGCCATAGCGAGACATCCATACCGGTTTCAAAGTCGCCGCCAAACTTCACCATAATGGAACTGTCATCACCAGCACCT
GGTCTGCCCGATATCTTCAGCTGATGTTCTTCACACACTGCGTAGGCGTGCTCAATGTCGTCGAAGCATAGCAACTCTACTAAGTCTTCTAGAGGATATG
TCTGGCTGCGATAGGCTCGATTCATACGGAGCAGAGTGGAAGATCGCACGTTCGGGATGTACCGGAAGAGCAGACACGACTGCAGATACGTCGCTTGACG
TAGCAGCGAGAAAAACTGAAAGTAGTCGCCTGTATGACGAGCGACAAACACGCGCATCGCGAACTTCATGTGCGGACTCTCCAGGATATGACGCGAAAGG
TTCTTCACATATTTCAACACATCCATACCACGACCATTGTCCAGCGTACACAGGATGAAATACGCGCGACACTCCGCTTCAAACGGGCTCAAGTACGCTG
GATCCCCGACCTTGTGGCTCTCGTCGTACAGTTCGTTCAGCGACTTGAGCGTTTGGCCAAGCTGCTCCATGTTCTGTTGCGCCACGAAGCTTTGGACTTC
GATGAGTTCGTGTTCGCTGAGCACGTGATAGCGCGCGATACGCTCGTGAATGTCAAGCGCAATGGGGTGCACTCGACCGCCAGCGCCACGATAATTCTGG
AGCACGAAATCTTTGCGGATCATTCGAAATCGGTCCCAACAGAAGTTGTACAGCTCGATAGGCTCCGGGATTCGAGGCGTCTGGAAACGAGGATCCAAGC
CACACTGATCCAGGTCCATGATAGCCTGCTCGATATACAGCTGTGTACGTCGCAGAACACCGGGAGGACGGATCTCCTCGGCGATATCCAGCTTGTGGTC
TGCTGAACTACGCTGGAACCGCTTGATGATCATGTCGCGCTCGGTTCCTGGGCGATCAGGGAAGCACTTCTCGAAGACGCTCAACTCATCGACTCGGATA
TGTAGCTCCCGTTCTGCTGGACTACACATGTCAGCACAACGTCCATCCAGGTTTTTAGCAGCTGACAGTTCAGCTTTACTGCTCTCGTCTCGGGATGAAG
CAGTAGCAGACGACATGATTGCAAACGAAGTCTCGTCATCACTTGTGCTCGGCACTTTTTTCTTCTGTCGCCCTTGTCGATGTTTCCCTTGTCTTTCATG
TGTTGGACTTGTCTTAGGCGCCTTAGCCTCCCCGAACGCATCTCCATCAGGAGGGAACTTAGGACTGATCCTAGGTTTCAACTGCTGACCATTGAAGGGA
TTCGTATCCTGTTCCGGAACGCGTTTGCCCTTCCCGAATGATTTCTTAGCTCCATTCATTCGCGCCTCCATGGCCGAGTTCGCGAAGCCTCCAGCTGAAA
TATCCGAGCCAAATTTCGGACCGGTCTGTCGTCGTTTATCGGTAGCACCACCGAATGCCGTAGCCGCGCTACCAGGAGGAGAAGGCTTTCCAAATGACGG
GGAAGTCTTAAAGCCATTCCCACCCGATCCACCAAAAGTAGTCTGGACAGTAGGCCCACTCAAAGCCCCACCACTTCTGGCTGTAGATGCGAATGGGTTG
TCTGCACGAGCAGAGGAAGCTGCCTTTGGGGTGATCTGTTTCTTGCGCACTTGAACTCCTGACGCCTGACTCCCAAACGAAGTACCTGGCGATGATAATG
GTGTCGGTACTCCAGTACTTCCAGACCCAAACCCGTCAGCCTCTTGTGAGAACCCCTGCGTAGATGTACCGAAAGCTATCGGTCCACTGTTGAAGCCATT
GTCACTCCCACCGAACGCTGTGCTTCCTCCACCGAATGCAGCCTTCGGAGCACTTCCTCCGAGCCCTGAACCTCGATTCTTGCCAGGATTCGACGCTGTT
CCAAACGTCGTGTGTGCACCGGCTGATACATTGGAAGACGCCACGCCGGTACGTCCAAATGACGTCGAGCTGAACGTCGTCCTGGAACTGTTCTGAGTCT
TCTTGCTGCTCTGCTGGCCGAACGGATTCCCGCTAGTTGAAGCTCCACCAAATCCTCCTGATGACACTGAAGATGCCCCTGCTAAGCCTCCAGGCGGAAG
AGGTGGCTGGTTTGCAAATCCGCCACCTAAAGCGCCCGCCATGCCGCCCGGAGGGAGGGGAGGTTGATTGCCGAAGCCGGAGCTCTGTCCGAACGTCGTC
TTCACGGCTGAAGCATTACTATTGGGCTGGAAGGGATTCACTGGCGTCGGTCCTGGACATGCGAAGGCATCGATCAATACCTGGAAGACTCAAACACTGG
CTGCTATAGAGACGAGAGAACGTGAAGCCCTCCACGAGAGCCGCTCGTCCACCTGCACTGTTATTCACAGCACGAGCACGTCCTCCCACACGCCAAAGAG
AACAGAAGTAGATACGTAGCCAGTCGTACCTTGATTTTGGCCAAATGGATTGCTACCTTGCGTCCCGAAGCTTCCGAAGCCGCCACTTCGATCTACGGAT
GATGGCAAAAGATGTGTCAGCTCAGAGCTTGGCAACCACGTGGCCAATAGCGGCACAAGAGGGAGGAACGAGGAGAATATAGGGAATGAAACGCACTGCC
GGAGCTGAACATTGCAGCGTCGACTATGGAGTTGCTGTACACGAGCCTACGTCAGGTCGGCCGCCACCTTAGGAGCTTTGAGACTACTGTAACTGTACCC
CTGGGATAGAATTTGTTTCTAAACATTTTTTTTTACTATCGTACTTAATCAGATCTTTAAGCTATGCATTTCTAAACGTGCCTTCCTGCGCAACCTGATT
GGTTGTGGCCGAGGGACTTAGTGAGTCCAAGTCAATTTAAGGACTGGAGAGCGGCAACCACCAATTCTTTCAGCCAGTGACCCCGCTAGCTGTTGGTGGG
CTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAAATGCGCGCTCATGACGGGCCTCCAAGCAGGAACAACACTCACCTGTCT
TCCCCCTCGTTGTGCCTGTAGTTGAAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCACTTCCACAAGTACTGGGAGTCCCGAATCAAGACTTG
GTTCGACCAGGTAAGACAGCCGCGAGCAATACCCACAGCCAGCTAGCAGCGTTAAGCGACACACCGTCTACAGTCTCTCCATAAGTGAACAATTCTGCTC
GAGGAGACATACAGGTCATTCAGCCACACGAAACGACACGCAGTTAGATCATTAGGCATCAAGAAGGGCATCTACAATGGAGAGACGTGCAGGACCGTGT
GCTGGCTCAATTGCTGGCTGGCTGGTGGATACAGGAAAGATAGCAAGTGTACTGATCGCCACGATTTTATTTGACGTCCATAGGCTTCCAAGAAGAAGAC
CCGTCGTCTCAGACGTAAGGCTAAGGCTGCTGCCATCGCCCCGCGTCCGGCCGCTGGTCTACTGCGCCCCGCTGTGCACTGCCCCACGATTAAGTACGGC
TCGAAGGTCCGTGCTGGCAGGGGTTTCACCCTGGAGGAGCTGAAGGAGGCTGGCATTAACCGCAAGCAGGCCATCAGCATCGGCATTGCCGTCGACTTCC
GCCGCACCAACAAGTCGGTTGAGTCGCTTCAGGCCAACGTGCACCGCCTCAAGGCCTACAAGGCTAAGCTTGTGGTGTTCCCGCGCAAGAGCAACAAGCC
CAAGAACGGCGATGCCCCCGCTGAGGACGTGAAGAACGCTGTGCAGCACACCGGCCCGATCCTCCCGATCACCCGCTCGAGCATCAAGTCGACCACGGCC
GTCATTACGCCCGAGATGAAGGAGAAGAGCGTCTTCACTCAGCTGCGTGTGGCTCGCGCCGACAAGCGTATCCTTGGCAAGCAGGCCAAGCGTCTGGCTG
ACAAGAAGGAGAAGAAGTAAGTGTCGTTTGCGTCGACATCTGCTCGTCTGCCCTCTTGACCGACTCGTGTTAAGAGGTTCGGCACTCCCTAAGGTCAATT
GCGGAAAATTGGAACACAATATATCGCGCATCAAAACAATAATCGTGTCATCGTGGTGAAAGCTTACTGCATGCATG