Description :
From Genome Similarity Track
Location :
Scaffold_516:3259- 9385
Sequence
6126 bases(100 bases per row)
CTTCAGCTTTGGACACATGTACCACCGCGAACAACCGATAGGGTGTGCTTGCGACTGCCAATCTCACTGCATGGTCGCCGCATTATTTAGCTACCCGAAA
TGGTCCATAACACATATGAGCTAGCTTTCGAGCGTACCCATCTTTGACGCGATCCAAATATAACCATACTTGTGATTCTTATTTATCTTCAGCAGATCGC
GGTTTCGTTATGACGATCCGCTCGGTCTTGAATCGCGATCTTCAGCCGATCATTCACGACTGCCCTCGCTTGTTGATATTGGCGTTGTATATTATACCTC
CATCTTTTGGGATCGCGATCGCGGGGTTTGACACTTCCTAGTGGTAAGGTCGCTACCGACGCCGATCGAGGGTCCCAGCCATGGATCAAGTAGAACGGCG
TTTCTCCGCGGACTCGATGTTGCGCTGTATTGATCGCATAGGTTAATCGCTCTGCATATTCGTCCGAATCTCTCTGATCTTCATCAGTGACGTACATTTT
GATCAATCGTGTCAGAGTTTGAACCTTGCGTTCTGCGGTTTCGTTCGCTTGAGGTCGATAAGTCATTTTGTCCCGTCGCTTCTGTCCCGCGATTTTGTTG
AACGCTCGGAAGAAATCGGACATAAATCCTGGCTCCTGGTCCTAACGGATGGCTTCAATCTCACCGAATCTTCGAAATACACATTCTTCATACTTTTCTT
CGATCGTCTGTGCAGTTTGTGACGAGCTCGCCTTTGCGATCAGATAGCCTGAGAACAGATCGACCCACAGCAACAACTCTGTATTTCTTTTAACGATCGT
GGTAGAGACAGAATGTGATTCATGGCCAAAATTTGAAATGGGTAAGTCTCTTGTATGTTTCCTGGCGACCCACCCGATCATGCGGGCAACCCTTGCCGGT
TTCACAATTGACGCACTCGCCTATATAGCGCTGCACTCTTCTGTACAATCTTCTCCAGTGGAAGTTTATCCTAATCCGTTGATATGTGCGGCCTACTCCT
TGGTGCCCGCCGTCCAACCTAGTATGGTAATGATGTACGACATCTCGTTGCAACAACTCGGGAATTACCAGACGAACCGACTCACCACGATCTTTGCTTT
TTGCTGCTGCCCTAGGACAGGAAAATGAAAGTCCATCTTGGTCGACTTCGTAGTCCGGTGCGATTAGGGAGCATCTTTTTGCCTCTCTAGCATTCAGCAT
GGCTATATCCCCAATCAGATACGCTTTCAAGTCAGATATCCAATTTTCCTCATCTTGCGCCTGATTTATGTGCTCAATCCAGACCTGTTGTACAATTTCT
TCTTGCAAAACGGCCGGGTAACATCGTCTTCGCGTCGTTGACCGCATGATAGTACCTTGACTGGGGGGCAGGCTTGTCTCGGTATCAGTAACTCATTCAA
CCGATTAAGCATCATGAGATTGTTTTGTTCCTGGTCTGATACCACGGCGCCCCTCTTCTCCTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCTGG
TTCCAGTCCCGTTTCATATGTAGAAATTCGTGCTTTGGCCATGATCGGAGTTTCTCCATTGCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACAAT
CAATTTCGCCCCGCATCTGTCTGATCACCAAGTTCGAGTCACCACAAAAGATCGCCCACCCCTTAGCCTGATCAGCCAGTAAATCAAACCAAGCAATAGC
CCACGGTATTCCGCTTCATTTATTGTCAAATTCTCTGCAAACTCGGAAATAGCAGCCACGATCGTCCACTCAGGTAACTTCCATAAATATCGCACTGTAG
GCGACGCCCTTGTTCTTTACCCTAGCCGATCCATCAAAAATGAACACCAGGACGGGTTCGTCTGCTTCGACCGTGGGTGGTAGTATGCTTATGGTTTGCC
GTGGCTGTTTTCTTGGATCAATCGCGATCAGGACTTCGTCTACGTCTTTGCGGGGTGTCACACTTGCGGTTAGCATACCCAGCATTTCGTCTTCGCCTTT
TTCACATCGTCGGATATCTAAATTCCAGTTTGATAGCAGCGACGCCCATATCCCTAATCTTCCGTTGAGACTAGACGACTGCAACAGCCAAGCCAACGTT
GAATATCTCATAAGTACTATAAACTCTCGTGAAACCAACATCGTAAGCCAAATGTCTAATATTCGGAGGAGAGCTAACACCTCTTTCTTGACCGTTCCAT
AATTGACTTCATTGGACTTCAGCTTGCGGCTAGAAAAGGTGACTGGCCAATATATTCCGTCGTATTCCTGGAGCAATGCAGCTGATACCACGCACTTACT
GACGTATACCACAATCACAGGCGCTTGATTTGGATTGAAATGTCTTAAGATTGGGGTTATAGCAATTTTAGCCTATAACAGAGTAAAATCTATTACCGCT
TTCTTCCATCAACTTCTGTTTCCGAACTCCGGATCGCCCCCAACATTTTGGTCCAGATCACCCCCTGTATTTGAGCCAGGAATGTGTTCGGACCCATCTC
GTGAATCGTGAATCGCGATCTCGATCTGATTCGGTGTCTGATACAAATAGCTGAACATATTTGTCTCGGCTGATCTCATAAAAATCCGTTTCCCGCAGCT
CATAGAGCACAGAAGCATATATCGCAAAGTCTTCAATGAAGCGACTGTAGTAATTTAGGATTCCCAAGAATGACTGCATTGATCGCAGAGTTCGAGGAAA
GGGAATATTCATAATTGAATCTTAATCCGTGGAGTGGGCTTCCATTTCCTCGAGCAAAACTTGATGGCTTTTGTAGTCGACCTTGCGACGCCCCTAGAAA
ATTTTGGCTACACTGATCGATAAGTTTCATCTATCACACACTTCCAACAGCCGTTCCACCCTTTCATATAGGGAAGTCCATGACGTAGCAGGTATCAAGA
TGTCGTCGGTATACGATCTTCGACCTAGGACCGACGGTCTAGGGTTTGTATCCAGCACTCCGTCAGTGAACACATCGGTTAGCGTAGATGAAGGTGTTGT
ACTCGAGTTAGATTTTGGGCCGATCTTCAGATACCCATATAGTGCAATTTCGATCAGTTGCTGGTAGATCTGGGGAGCGTTTTTCAACCCAAAAGGCATT
CGTAAACATTCAAACAAACCCGAAGGTGTGACGAAAGCGTAAATAGCTTTTGCTCGTTCTGTCATCTCCACCACCCAAAATTCACTCGCCATATTCAAAG
AGCAATACCACATCGCTTTATCCAGGTCTTGCAGTAATTCGCTAACCAGTGGCATGGGATATATTATCAATCTTGTCAACTAGTTCACCTTTCTGTAATC
AATGCATAGTCGTATATCTTCCCCATCTTTCTTGATGATCGCCACAATAGGGGAAGCCCAAGGTGAGGTGGATGGTTGAATGATCTTGGCCGATAGTAGT
CCCTTGATCAGATCTGCCAGTTTCTCTGGATATTTGGGTTCCACTGTCCGTACTCTCTGCGCTATCGGTTTAGCACTGCTGACATCAATATCGCATACCA
CTCCACGCGCAGCTGGAGGCAGGGCATTCCTCTTCCCTATGAGTAAATGGCGATTCTTCCAGATCAGTTGTTGCAACTTCTCTTGATCATCTGTCAGTGG
TTTACCTGGGTCGCAGAATTGGATGTCTTCGATAGCCACCTCTACCGTGGGAGCGACTATTTCTGGCAAGATTGCCATATGTTGGTCCACGTTTCGGCGA
ATAGGTCAACCGTGTCATGGCGATATACCGCAGTTTTCGTCGGATTGTTATCTGCTGAGTCTTCTTCGTTCGTGGGCGTTGTAGCGCTTTTACTCCCTTA
ATCTGACAGTTTTGATCCTGATCGTCCTCATCCCAGCAATCATTCTCGATCGCGACCACCTTTGCTTGTACGATCGCCTCATCTAACCGGTTCTGTGCCG
GATCGCCCTTCCCTGCTTTTGCAATCATACTGACCGCAGCAGGCATTTCTAACGATAGCTGTTCTTCATTGCAAGGGCGGTCTACATTCTCGATATTAAC
TCGTTTATCGTGATTTGTAATATCTGACACCCCTGGTTGTGACAAGACCTTCCCCGATCGGCTTACCCCCGTTTCTTTTTCTTGTTTCTCTCTATGCCTC
AGAATCTTCTTGGGATGGTGTACGACGGGTGGTCCAATAGAGGCCCCGAATACTCGATCGGACGTTCTTTGATTAACTTCGTTGTGGCTTCGAATGCCAT
AGTCGGCGATTCATTATACCGGCGTGATCCGACCTAAACATAACCCGGTGATCGAGGTATTATGTCCATCATCATCCGCCACGCTAGATGTGTATCGTGA
TTGAGAATTACCTCCTGATCGACGATATTGGTTAGTATCAAATACTTGATCTGTCCGGGGCCAGTAGTAACCGTCGGTACCCACTTCTTGTACCGCCTTA
CCCATAGTTTGGATTTAGGGAAACCTGCTCCAATCTTCATTTCTGTGGATCCTCCGACTGGGATTACCACATGTTGATATGGGGTTTATATTTACTCCAT
ATGGAGGTCGTCGCCCTGCCAGGTGAATTTTCACTTCGTCTGGCAAACAAAGCGTTTCATCCGCTAGGTCCAGACGTATCCCTGCTGGCAACATAAAATC
CATACCTAAGATTGCTTCTTGGCCAACTTGATCGCCCACCCAAACGTCAAAATAATATACCAGTGATCCGTTTAGTGTGATCTTGATCTTGGTGCACACT
TCAGTCATGTAGGCGATCTCCCCGATTCCCACACATTCTCGCTTCTGGCTGTCGTCGATCATACACCTCACCTTACAAGCAAAGGTAACGTCGATGATTG
AGACTTCGGCTCCAGAATCGAATAGCATAGTGGCTCTTTCGTTGTTGTTTCTTGCCCACCGCTTTAGCTTGTTCAAACCACTTTCCAGATACTTCCAATA
CCCCTCCATGCGGTATTGACCGCTCTCATGAACCTCCCCACAGGCGGGACACACATGTAGGCATTTTTCCGAGGGATGTACTTTGGGGCCACACTTTTGA
CAGGTCAATCGTTTCCAACATATGCGATCATCATGACTTTTCGAGCCACAGTGTGTGCAGGCTTTCGAAAGTCCGAAGAGATCGCGATCGTCGTCCCGAT
CTGTCTTCCGCGATCTGTCTTTAGCGATCTGTCTCGTTGCTCTCCCGGATCTGCGACCTGATCGAAGACGGTCGTTACACAGACCTTGCGCCGAAACTCT
TCTTCATCCGATCCTTCCGAGCTTGAGTCCGAGTCGCTTTCTGCACTCTCTACGCGAATGGCTTTCACTGCCCGGGGTGTTTTCGAATACACCGGAGCCG
ACGCTGTAGCCGATCGCGATCGAAATTTGTTCGATTCGGCCGGCTATTTATTCTTTCGAAAGCTCATTCGCTAATACGCGTGTAGAGTTTCTTCCATCGT
GTTCGCGCCATGTACTCGCAATAGTGGCAGTTGTTTCGCCAGCTCTCGATCGTCCAAAGTATCAATGAAGTGCTCCACATGCTCACGTCGGCATGCTGGC
GATCCATCTCTGAACACCACTTTAGCTCACATTCCTGCCACATTCAGCCGGTGGAGATATTCCAACGGGGTCTCATCCGATCGCTTCCGCGCATGGTACT
ATTTCCTTCCTGCAGACATTCCGCATCCTTCGTATTGGACCATGAAACTTTCTGACAATGGGTTGCACTCATTGGAGGTCGATCGGCTGAACTGGTTGTA
CCAATTTCACGCAGGTACTGTCAGCAGATCTTTAAGAACCAAACATTTTTCATCATCGGTAGATTAATCGCATAGGAAGGCAGTATTCATCTCGTTAAAC
CAACTTCTGGCACGTTCTTCGTCTTGGTCCCGCCCTGCAAATTCTTTCAGGTCCATCATCGCCGACAATCTTATCCTCTGCGCGCTGAAACCTCCAGTAG
GTGCGGTTCCTGCGGTTGCCACCTGCGGTCGCCTTAGGTCGCCGAATCAGTTACGGTCTTGATCATATTCGCCCGATCGATCACGGTACGATTCAACTGA
TTCCATTTTGACACCTTAGATATATCGCTCTTGGGAACTCGTTGTCCTTTCTTGGACGACCTGGTGACTTCCTCCTTGTCCTTCGCGATCGCGATTGAAC
TTGTCCATAGCAGCCTTGAAATACGA