Description :
From Genome Similarity Track
Location :
contig_47:325858- 326954
Transcript NameFunction/comments
g7886.t1hypothetical protein PHYSODRAFT_350602

Sequence
1096 bases(100 bases per row)
TCACTACCGTTCAACTATTCTCGTAAACCCGGAAAGCTGATCAAACTAATCGTATCTCCGTCGTACTTGCAGGACCATAAAATCTACGTGCAGACACGAC
TGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGCTGGATCCGCGAAACGAATGCCGAACGACGTGTACGA
AGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATGAAGACGTTGGCTCGCAAGAAGCGCTACGTCGTCGAA
TCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTCGGTGCACTTCACCTTTTATGATTCGCTAAAAACACA
CAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGAGGCTCGCCAACCTCACGCAGACGCCTGAGCTGCACG
AGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGATGGCAGGGAGGGCATCGAATCGCACATCCGTCGGTG
GTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCCTACGCCATGCAAGCGTCCACTTGCTGCAGTCCATTCTGCAGA
GCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCAAAGCAGACACGAAGACTCGTCGGCTGACGAGCTGGA
AGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTTTTGATGTGCTGGTAGTACGTTGCTAACGGAGAGGGT
TACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAGCGCATTCGTGTGCAAGGTAATTGTCTCTGTCGCAAT
GTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTGCCTCCACTAAAGAGTTACGCACTATCACCACG