Description :
From Genome Similarity Track
Location :
contig_136:32580- 33773
Transcript NameFunction/comments
g13688.t1hypothetical protein

Sequence
1193 bases(100 bases per row)
TATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCC
ACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGT
TCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCATATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCA
TCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCAT
GCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCT
TCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACA
ACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAG
TTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGT
TGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGT
GGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTC
CATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACG
TGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCAAGATAAATGAACCAAACGAAAGCT