Description :
From Genome Similarity Track
Location :
Scaffold_60:32576- 33853
Transcript NameFunction/comments
Physo_109098putative exo-1,3-beta-glucanase

Sequence
1277 bases(100 bases per row)
GTCGAAGCCGTTCTGCGAGCCGATCAAGCCGTGGATGTCGATCAGCAAGTCGATGTTGTACTTGTAGGCGAGGTCGGCGACGCGGTCGAGCGCCTCGACG
GCGCCGTCCGTGCACCCGATGTACGGCTCGTACGGGTTGAACATCCAGTCACCGACGGGGACACGCAGCGAGTTCACGCCGGCCTCGGCCATCTCCTTGA
GGTCGCTCTCGGTCACCCAGGCCTCGTAGTGGATGCGGAGTTGGCGGTTGGCCTCCTCCTTGCCGAGCGCCGTACAGAAGGTGTACATGTCCATCGCCGT
CTTCTCGGGGGCCTTGTCGCCGAAGCGCTGCTGAGTGCCCAGGAACTGGTAGAAGAGCGTGGGAGTGATCCACGGCTCCAGCACGAGCCAGCCGCCGAGG
TTGGCGCCACGCACCTGTCGGTTGAAGGGCGTGGCGTGCCGATCGCTGGAGCAAGTTTGGTTCTCGTCGTTGGGGTGAAAGTTCTCGAAGAAGTCGAGGT
GCGCCGAGTTGAAAACGTGGTCGTTCTCCCAATACCACTTGGCGTCCTTGACGACATCCCCGTTGTTGGCGCCCAGCGTCGTGTCCAGGACGTGGTCGAC
GGGCGAGGATGTCGAAGCTGCCAGCGACAGCGCCGACAGCGCTGCGGCCACTTGAAGCAAGACTTTCATGTCAACTCGCAGACACCGGAGAGTCGAGTGC
GGAGCGGAGAGAGTTGTGCAGTGCGCGTCAAAAGCGGAAGTGAGCAAGAGAGCGCCTCAAAAAAGCTCTCGCCGCGGAGCCATGCTGCTGCTGCCACCAG
CGGTGATGTCCCCTCGCCCGGCCGACCCACGCTTGCTCGGCTCGGCCGGCTGTGCCCGACACAGACCAGGCAATGAGTCACGCGGGAAAAGCCGCGCAAC
AACTTCAACGCCGCAAAGACCGGCGGGCGCTGGACGCTCGCCATTGCGAGCAGCAACTTTTTGTCGGCAGCCAGCAGCAGCATGACCCGCGCAGCGGGCT
GCCGGTCGTGACCTCGGAGAAAACGGCGGCGGTCTCTGCTGATCGGCATGCGACGCATGCCCGAAGCCATCATGCAACCGGGAGGGCGCACTAAGGGCGC
GCTGTCCTCTGCCGCTCTCTCAACATTTAGCGCAGCTGCATGCGATAACCCCTTAATTAAAACTCCCCCGCGGAGGAGACCTCCGCCCCAAAGGCGCAGC
AAGTTGCGAAAACACGAGTTATTGCAGCTCAAGGGAGTAACAGGTAGTCCGATTATCAGGGGCCCATCTTCGACGTA