Description :
From Genome Similarity Track
Location :
Scaffold_155:32571- 36450
Transcript NameFunction/comments
Phymu_g5669hypothetical protein PHYSODRAFT_485908
Phymu_g5670hypothetical protein

Sequence
3879 bases(100 bases per row)
TATCTCGGATAGACTCGAGCAGTGCGTTGATAAAATCCAAGTCTGGCAGTGTACTTAACTCCGTGTTGTTCAACCTGTACCATCAGCAAAAAACGAGGGT
TGAGTGAGATGTATACCGCAAGTACATCATATCCCAAACACGTACGCTTTCGACATCTCATCCAGTGGCGTCGTGAGTGATTTCGCGCCTTGGACCACAG
CATCAACCGGGGATCCAGTGGCAGTAGCTCGATACACCACAGCGAGAGCCTGCGCGGCTACCATTCGCCGTGTATCTACCTCCAGCCACGAGCACAGAAC
GTCACAGCAATCTTCCTCCGATTTCTTCGTAGCTGCAATGGACGAaggcttctcctcttcttcgtccacagtCTCCATCCTGTCCGACTTGGCCTCAGCC
GTCGATGAAAACATCCCACTACCACCTGAGAGCTTGGATTCATCTGcttccatctcctccacAAACGCGGGCAAAGACAGCAGCGCAAACGTGTTGGGCG
AAGTGTACGGGAActtggcctccagcagcacggcagcagtcgaagctaGCTCCACCTTGACTGCCTCCGCTACTGCAGTCTCCTGCTTGGCAGCACCTTC
CGTCTTCAACAGCGCCAGTAGCTGTGGCAAAACCTCCGTAAAGATCGCTTCTCTAGCAGCCGGGTGGGTTTGCAGTGCCACAGCTGCGTACTCGCACGCa
ggtcgaagaagcgcattcAATctctgcgccttctcctctgcaCTGACACTCTCGTCCTTAAAAAGCGGGAACAGCCATCTCAATCGCTTCAGGACGTCGC
CAGCCGGTACTTGATCGCCAAAAGACTCTAGAACTCTGGTAGACCCCATcagcgccacagccttcAGTCCGTAGTAGCACTTGTGCGTCCAAGCTGGATA
CTGCAGCACCTTTTTAAAGGCATCTCGATACcgctgcagcaacggcgtcaTCGCTTGTCTCTCTGTCACATACCGGATGGTCTGCGCGTTGCAAcaatgt
aaaaaaaaatagtgTAAATTCCTCCATTGAATGGCCAGGAAAAACGTTGGAAATCCACTGTACCAATGACGCAGCGGACAGGAGAGTGCCCAGTTCCACT
TCGTGGTCGTGCGGCATTGGCTGGCCAGGAAGCGACGGGAGGAGCTCAgcgatggcgtcgtccagctcctcgatcacctgcagcaagaagacgaacgtGG
CGTCCACACCGACGCTCGTGGAGTGCACGCATTCCTGCACGTAAGCTAAGGAAGGGCCAAAAAGGAGTGAGAAtaggaagcagaagacggataaaaacag
cagcaagaacgcaCCGGCGACGCCTCCAGACTGGGGATCCAGTAGGGCGCGCGCCAGATCGCGGCGCgtcgtggagctcatggGCAAAGTGATCGCAAAA
GTGATACGCAAATCATGATTTGGAGGTCGTTGGTTGGCCAAGCGAGCGTCccatacaaatatcaagtgTAAAAGAGTGTCAAAAAGCTTCAACGTGGAGA
ATCAGCGATAAAAAATATCTAGTTTTTTTGTTTCGTTTAAGAGAAGAAAGTAAAGTTGCGAATTGCTTTTTTCGTTTCATTCTTCCTTTTGACGCTTTGG
TGCGGCGCCATCGGATTTGTCTTCGCTACCATCGATAGCCTATCGAACAATCGAAATGAACGCATCGGGACGGTCGGCCGATTGCGGCTCGCTCCTGGGT
GCAAAGTGCAGCGGACCAGGTGCCATCGACGAGTTGTGCACATGTGAGAACCAGTAGTTTCGCTGCGCTGCGCTACGATGGACGAGGCGCGCGGCAAAAG
CAAGTGGACCGCCTCGAGAGAACAACGCCGGCAGATAGTGCGACACTGTTTGAAGGCCGAACTAAGTTCAGGGCGAAGGACAGTGACGCTGCGCTGCGGC
TTTCGGACTCGatggccagcgccagcacaagaagcagcgctgaaCCTCTCTCTTCCTGACGGACCCTCACACTTTGACAAGCATCGGCACTGCGCTCTAT
TTTTCAGCGATAAATTCGAAGATAggtcgttgaagctgtcgtctTGTCTGCCGCTCGCTTCTCCGGCTCATTTTTTGAGTCGGGAAACTTGGCCTGCGAC
GCCGTTTGCCACTCTCCCACACGTTGAGAATTCTGCCAAGTTggtggcaatttgccactgGCAATGCAAATGTTGAGTGCAATTTTGCCACTGCAACTGC
CACTGCAAAACGTCGTGTGTCAAGTGGCTCGCCTTCAGATTTGTCTCTCAGCTGATCCCGATCCTTATCAACGCAGCCAATCAGTAACACGTGTAGCCAA
CTATGCGTGCATAGCCCGTCCCATCGGTCAAAAAGCAAGAACGCGGGAAAaatggaagtggaggcagcTCATGTCTCGTCATGGGGGGGACCTCATAACC
GAATCAACAGCACAAGCCACAGTGTAGCAATGGCGTCCGGGGGCGGCGTCCAAGTCAAGGGAGAagccgcttcctcctcgttACAGGACGCGGGCGACTT
ACGTCCGCTGCGGATCCGCGTCTCCACCCCAGTATCCCCCAATcgcgacagcttcaacactCCAGATGGCAGCGAATCCACAGCTTCCGGTCGTGGCGTC
AAGCGCCCGAGGCGTGAAGAGGCCGCGTTGTTCCTGGAGAAAACGTACGAGCTATTGGAGCGCTGCCCTCCCGAACTGGCTAGCTGGACGGCAAAGGgcg
acagcttcgtcgtGAAACAGCCCTCAGCCTTCGCGGAGCACGTGATCCCGACGTACTTCAAGCACCGCAAgttcagctccttcgtgcGGCAGCTAAATCT
CTACGGCTTTAGGAAAGTGAGAGATTCGCCAACAGTTGCGGTCGACGATGCGGACGTTATCGCGGTCGAAGACGCCAGCCCCAAAGATTGGTGGGAGTTC
CGTCATGAACGATTTGTGCGGGGAAGGAGAGATCTGCTGTGTGAGATCAGAAGACGATCTCCTAGTGATGCCAGAGTTTCAACACCGTTGGGGGCGGCTA
CACCTGTGGAACGCGTTGAGTTCGAGGAGCTAAGAGGTGAAGTGATCGGTCTGCGTGAGGATATGCACAAGATGCAAAAGACCAATCAACACCTAACGAG
ACTGCTGCAAGACCTTTTACAGCGATTTCCTGGAGTCGAGAATGACGGAGGGAAAAGCGTCAATAGGCAGGAGTTCATTCAAACGCCAAGCTTTGCCAAC
TCCCCCTCTGTCCAACCTAGATCTCTGCCTTCAATAGCGTTACCCAGTCCAACAGCTAGTGGCAGCCTCAGCGGACCTCAACTAGCGCTACTACAGCTCC
GGCAGGGACTTCAACCGCAAGGAACGCCGCGAGGCATTTTGACACCTCGAACACCCGCCTCGGGGTCTTTTCATTTACGACCGGTACAGTCGCTGATGGT
GAATCTGAGCCCCAGCACCCGGCCAGCGCCTAGTCCGCGACCAACTGATAGTTACGTTGGCACTCCATCGtacagccaccaccagcatgAACAGCTCAGC
CAACGTTGGTACCAAACCACTCCACTTACTCACCGGTCCCCGACAGCAAAGCGTTCGCCTTTAAAGCGAGTGGGTGTAGACTCTGCCACTCCCGTTTCAG
AAGCCCAGACGACTTACGGTCTCCGTTCCCCCGAAGACGTAGCTGTCCGTGAACTAAGCCGTATAGCCTCGGAAATCCGCGTCGACCTGCTAGCTTGCAT
CACTGCGCGTGTCACGGGCTTTTTACGCGTGCATCGCGATCAAACGGAACCAactcgagaagcagatgctGATGCTGTAGCCGAAGCTGTTGGCTCCGAC
ATCTGTCAGAagctcacgctgctgcaagCTTCAACGACTACATCAGACCCGAAGCTCTTAGACGCAGAGACAACTTGCA