Description :
From Genome Similarity Track
Location :
Scaffold_516:3257- 9276
Sequence
6019 bases(100 bases per row)
GCCTTCAGCTTTGGACACATGTACCACCGCGAACAACCGATAGGGTGTGCTTGCGACTGCCAATCTCACTGCATGGTCGCCGCATTATTTAGCTACCCGA
AATGGTCCATAACACATATGAGCTAGCTTTCGAGCGTACCCATCTTTGACGCGATCCAAATATAACCATACTTGTGATTCTTATTTATCTTCAGCAGATC
GCGGTTTCGTTATGACGATCCGCTCGGTCTTGAATCGCGATCTTCAGCCGATCATTCACGACTGCCCTCGCTTGTTGATATTGGCGTTGTATATTATACC
TCCATCTTTTGGGATCGCGATCGCGGGGTTTGACACTTCCTAGTGGTAAGGTCGCTACCGACGCCGATCGAGGGTCCCAGCCATGGATCAAGTAGAACGG
CGTTTCTCCGCGGACTCGATGTTGCGCTGTATTGATCGCATAGGTTAATCGCTCTGCATATTCGTCCGAATCTCTCTGATCTTCATCAGTGACGTACATT
TTGATCAATCGTGTCAGAGTTTGAACCTTGCGTTCTGCGGTTTCGTTCGCTTGAGGTCGATAAGTCATTTTGTCCCGTCGCTTCTGTCCCGCGATTTTGT
TGAACGCTCGGAAGAAATCGGACATAAATCCTGGCTCCTGGTCCTAACGGATGGCTTCAATCTCACCGAATCTTCGAAATACACATTCTTCATACTTTTC
TTCGATCGTCTGTGCAGTTTGTGACGAGCTCGCCTTTGCGATCAGATAGCCTGAGAACAGATCGACCCACAGCAACAACTCTGTATTTCTTTTAACGATC
GTGGTAGAGACAGAATGTGATTCATGGCCAAAATTTGAAATGGGTAAGTCTCTTGTATGTTTCCTGGCGACCCACCCGATCATGCGGGCAACCCTTGCCG
GTTTCACAATTGACGCACTCGCCTATATAGCGCTGCACTCTTCTGTACAATCTTCTCCAGTGGAAGTTTATCCTAATCCGTTGATATGTGCGGCCTACTC
CTTGGTGCCCGCCGTCCAACCTAGTATGGTAATGATGTACGACATCTCGTTGCAACAACTCGGGAATTACCAGACGAACCGACTCACCACGATCTTTGCT
TTTTGCTGCTGCCCTAGGACAGGAAAATGAAAGTCCATCTTGGTCGACTTCGTAGTCCGGTGCGATTAGGGAGCATCTTTTTGCCTCTCTAGCATTCAGC
ATGGCTATATCCCCAATCAGATACGCTTTCAAGTCAGATATCCAATTTTCCTCATCTTGCGCCTGATTTATGTGCTCAATCCAGACCTGTTGTACAATTT
CTTCTTGCAAAACGGCCGGGTAACATCGTCTTCGCGTCGTTGACCGCATGATAGTACCTTGACTGGGGGGCAGGCTTGTCTCGGTATCAGTAACTCATTC
AACCGATTAAGCATCATGAGATTGTTTTGTTCCTGGTCTGATACCACGGCGCCCCTCTTCTCCTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCT
GGTTCCAGTCCCGTTTCATATGTAGAAATTCGTGCTTTGGCCATGATCGGAGTTTCTCCATTGCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACA
ATCAATTTCGCCCCGCATCTGTCTGATCACCAAGTTCGAGTCACCACAAAAGATCGCCCACCCCTTAGCCTGATCAGCCAGTAAATCAAACCAAGCAATA
GCCCACGGTATTCCGCTTCATTTATTGTCAAATTCTCTGCAAACTCGGAAATAGCAGCCACGATCGTCCACTCAGGTAACTTCCATAAATATCGCACTGT
AGGCGACGCCCTTGTTCTTTACCCTAGCCGATCCATCAAAAATGAACACCAGGACGGGTTCGTCTGCTTCGACCGTGGGTGGTAGTATGCTTATGGTTTG
CCGTGGCTGTTTTCTTGGATCAATCGCGATCAGGACTTCGTCTACGTCTTTGCGGGGTGTCACACTTGCGGTTAGCATACCCAGCATTTCGTCTTCGCCT
TTTTCACATCGTCGGATATCTAAATTCCAGTTTGATAGCAGCGACGCCCATATCCCTAATCTTCCGTTGAGACTAGACGACTGCAACAGCCAAGCCAACG
TTGAATATCTCATAAGTACTATAAACTCTCGTGAAACCAACATCGTAAGCCAAATGTCTAATATTCGGAGGAGAGCTAACACCTCTTTCTTGACCGTTCC
ATAATTGACTTCATTGGACTTCAGCTTGCGGCTAGAAAAGGTGACTGGCCAATATATTCCGTCGTATTCCTGGAGCAATGCAGCTGATACCACGCACTTA
CTGACGTATACCACAATCACAGGCGCTTGATTTGGATTGAAATGTCTTAAGATTGGGGTTATAGCAATTTTAGCCTATAACAGAGTAAAATCTATTACCG
CTTTCTTCCATCAACTTCTGTTTCCGAACTCCGGATCGCCCCCAACATTTTGGTCCAGATCACCCCCTGTATTTGAGCCAGGAATGTGTTCGGACCCATC
TCGTGAATCGTGAATCGCGATCTCGATCTGATTCGGTGTCTGATACAAATAGCTGAACATATTTGTCTCGGCTGATCTCATAAAAATCCGTTTCCCGCAG
CTCATAGAGCACAGAAGCATATATCGCAAAGTCTTCAATGAAGCGACTGTAGTAATTTAGGATTCCCAAGAATGACTGCATTGATCGCAGAGTTCGAGGA
AAGGGAATATTCATAATTGAATCTTAATCCGTGGAGTGGGCTTCCATTTCCTCGAGCAAAACTTGATGGCTTTTGTAGTCGACCTTGCGACGCCCCTAGA
AAATTTTGGCTACACTGATCGATAAGTTTCATCTATCACACACTTCCAACAGCCGTTCCACCCTTTCATATAGGGAAGTCCATGACGTAGCAGGTATCAA
GATGTCGTCGGTATACGATCTTCGACCTAGGACCGACGGTCTAGGGTTTGTATCCAGCACTCCGTCAGTGAACACATCGGTTAGCGTAGATGAAGGTGTT
GTACTCGAGTTAGATTTTGGGCCGATCTTCAGATACCCATATAGTGCAATTTCGATCAGTTGCTGGTAGATCTGGGGAGCGTTTTTCAACCCAAAAGGCA
TTCGTAAACATTCAAACAAACCCGAAGGTGTGACGAAAGCGTAAATAGCTTTTGCTCGTTCTGTCATCTCCACCACCCAAAATTCACTCGCCATATTCAA
AGAGCAATACCACATCGCTTTATCCAGGTCTTGCAGTAATTCGCTAACCAGTGGCATGGGATATATTATCAATCTTGTCAACTAGTTCACCTTTCTGTAA
TCAATGCATAGTCGTATATCTTCCCCATCTTTCTTGATGATCGCCACAATAGGGGAAGCCCAAGGTGAGGTGGATGGTTGAATGATCTTGGCCGATAGTA
GTCCCTTGATCAGATCTGCCAGTTTCTCTGGATATTTGGGTTCCACTGTCCGTACTCTCTGCGCTATCGGTTTAGCACTGCTGACATCAATATCGCATAC
CACTCCACGCGCAGCTGGAGGCAGGGCATTCCTCTTCCCTATGAGTAAATGGCGATTCTTCCAGATCAGTTGTTGCAACTTCTCTTGATCATCTGTCAGT
GGTTTACCTGGGTCGCAGAATTGGATGTCTTCGATAGCCACCTCTACCGTGGGAGCGACTATTTCTGGCAAGATTGCCATATGTTGGTCCACGTTTCGGC
GAATAGGTCAACCGTGTCATGGCGATATACCGCAGTTTTCGTCGGATTGTTATCTGCTGAGTCTTCTTCGTTCGTGGGCGTTGTAGCGCTTTTACTCCCT
TAATCTGACAGTTTTGATCCTGATCGTCCTCATCCCAGCAATCATTCTCGATCGCGACCACCTTTGCTTGTACGATCGCCTCATCTAACCGGTTCTGTGC
CGGATCGCCCTTCCCTGCTTTTGCAATCATACTGACCGCAGCAGGCATTTCTAACGATAGCTGTTCTTCATTGCAAGGGCGGTCTACATTCTCGATATTA
ACTCGTTTATCGTGATTTGTAATATCTGACACCCCTGGTTGTGACAAGACCTTCCCCGATCGGCTTACCCCCGTTTCTTTTTCTTGTTTCTCTCTATGCC
TCAGAATCTTCTTGGGATGGTGTACGACGGGTGGTCCAATAGAGGCCCCGAATACTCGATCGGACGTTCTTTGATTAACTTCGTTGTGGCTTCGAATGCC
ATAGTCGGCGATTCATTATACCGGCGTGATCCGACCTAAACATAACCCGGTGATCGAGGTATTATGTCCATCATCATCCGCCACGCTAGATGTGTATCGT
GATTGAGAATTACCTCCTGATCGACGATATTGGTTAGTATCAAATACTTGATCTGTCCGGGGCCAGTAGTAACCGTCGGTACCCACTTCTTGTACCGCCT
TACCCATAGTTTGGATTTAGGGAAACCTGCTCCAATCTTCATTTCTGTGGATCCTCCGACTGGGATTACCACATGTTGATATGGGGTTTATATTTACTCC
ATATGGAGGTCGTCGCCCTGCCAGGTGAATTTTCACTTCGTCTGGCAAACAAAGCGTTTCATCCGCTAGGTCCAGACGTATCCCTGCTGGCAACATAAAA
TCCATACCTAAGATTGCTTCTTGGCCAACTTGATCGCCCACCCAAACGTCAAAATAATATACCAGTGATCCGTTTAGTGTGATCTTGATCTTGGTGCACA
CTTCAGTCATGTAGGCGATCTCCCCGATTCCCACACATTCTCGCTTCTGGCTGTCGTCGATCATACACCTCACCTTACAAGCAAAGGTAACGTCGATGAT
TGAGACTTCGGCTCCAGAATCGAATAGCATAGTGGCTCTTTCGTTGTTGTTTCTTGCCCACCGCTTTAGCTTGTTCAAACCACTTTCCAGATACTTCCAA
TACCCCTCCATGCGGTATTGACCGCTCTCATGAACCTCCCCACAGGCGGGACACACATGTAGGCATTTTTCCGAGGGATGTACTTTGGGGCCACACTTTT
GACAGGTCAATCGTTTCCAACATATGCGATCATCATGACTTTTCGAGCCACAGTGTGTGCAGGCTTTCGAAAGTCCGAAGAGATCGCGATCGTCGTCCCG
ATCTGTCTTCCGCGATCTGTCTTTAGCGATCTGTCTCGTTGCTCTCCCGGATCTGCGACCTGATCGAAGACGGTCGTTACACAGACCTTGCGCCGAAACT
CTTCTTCATCCGATCCTTCCGAGCTTGAGTCCGAGTCGCTTTCTGCACTCTCTACGCGAATGGCTTTCACTGCCCGGGGTGTTTTCGAATACACCGGAGC
CGACGCTGTAGCCGATCGCGATCGAAATTTGTTCGATTCGGCCGGCTATTTATTCTTTCGAAAGCTCATTCGCTAATACGCGTGTAGAGTTTCTTCCATC
GTGTTCGCGCCATGTACTCGCAATAGTGGCAGTTGTTTCGCCAGCTCTCGATCGTCCAAAGTATCAATGAAGTGCTCCACATGCTCACGTCGGCATGCTG
GCGATCCATCTCTGAACACCACTTTAGCTCACATTCCTGCCACATTCAGCCGGTGGAGATATTCCAACGGGGTCTCATCCGATCGCTTCCGCGCATGGTA
CTATTTCCTTCCTGCAGACATTCCGCATCCTTCGTATTGGACCATGAAACTTTCTGACAATGGGTTGCACTCATTGGAGGTCGATCGGCTGAACTGGTTG
TACCAATTTCACGCAGGTACTGTCAGCAGATCTTTAAGAACCAAACATTTTTCATCATCGGTAGATTAATCGCATAGGAAGGCAGTATTCATCTCGTTAA
ACCAACTTCTGGCACGTTCTTCGTCTTGGTCCCGCCCTGCAAATTCTTTCAGGTCCATCATCGCCGACAATCTTATCCTCTGCGCGCTGAAACCTCCAGT
AGGTGCGGTTCCTGCGGTTGCCACCTGCGGTCGCCTTAGGTCGCCGAATCAGTTACGGTCTTGATCATATTCGCCCGATCGATCACGGTACGATTCAACT
GATTCCATTTTGACACCTT