Description :
From Genome Similarity Track
Location :
Scaffold_318:32565- 37581
Transcript NameFunction/comments
g10902.t1hypothetical protein
g10903.t1hypothetical protein
g10904.t1hypothetical protein

Sequence
5016 bases(100 bases per row)
CGTCGGCTCCGATAGATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCCAGAC
TTTTCTTCTTCGTCGGGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTTCTAAGCCAGCTCGGTGGCGAACGGGGCGCGATCTTCTGG
CAGTGTCGTCGTCGCCACTCGGTCGGCTCTTGCGCTTCCCCGCCTGCTTGAAGCTCGTTTGGCGCGGTCCATCGTTGTCGTCCAGGTCCAGCGCGTCCAG
GTCCAGCGCAGCATCATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTCATCGAAGTTGACATCGCGACTGACAACCACCTGCCCC
GCCTCGATGTCATAAAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCG
GCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGTACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGG
TGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTCCAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTG
ACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTCA
GCGAGTTGGTCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTC
TTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCT
TCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCT
GGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTCGATCATCTTGCGAAGCACCTCCACCGGAGC
GTGACCCATACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTC
GCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGCGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGG
AGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCC
CACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGGGCGAACTTGGCTTTGTCGTTGCAGATGTGG
TGCGTTGCGCCGCTGTCGACCGCCCACATGCCGAGCATATCCTTGGCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGT
AGCCGTAGTCGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTC
GTCCTTCTGCTTGGTCCAGCACTTGTCGATCGTGTGCCCCAATTTCCCGCAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCG
TCCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGCCGCTTGATGTGCTCATTCGTCAGCACCTTCACGACGTCTTGCGATCGCAGCTCCGCGCTGCTCA
TCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGGAGACTGCGCAACAGGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAG
CTTGGAGCTGATGTTGAGGACCTCGTTGCAGTGATGCAACACGTTCCCGCCTTCCGACATCTCCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCA
GCCTTCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCACGCAACCCACGCTTCCTCGCAGTCGTCGACCACATGGTGGTAGTCCGCGTCCATGTGGA
GCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTACTCGTCCTTGGGCCGCGAGTCCGTGAAGCTCGGCGTCGTCTCTCGGTTCACGACATGCCA
CACCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGTCGCGTATTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGAGGCGTCGTGG
GCAGAGGACATGGTGCTTGGGCTCATGACCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAGAC
CGGAGCGGAGACTGGAAATCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTAC
TGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCA
CAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGTAATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGAT
ACCAAACCGGTAACCCTCCATACCCTCAATACTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTTTCACGGGAAGACAGCCTTGGTATGTGC
GGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCA
AGAAGCAGCGGACGGTGGCGCTGTCTTCGACGGAAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGA
GCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAG
CACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTGTCGACAACGGACATGCTGGCGGACATGATGA
CGAAGGCGATCACTGCAGTGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGC
GCCTCGGGCAGCTGCCGTACACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGC
GGGACACTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGA
TTGGCTGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGG
ACCTAAATCAATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGCCCAAGACCCCGACTACGCCTTC
GCCATGGACGCCACCCCGACCGCGACCGCCCGCATCAACAAGTTCAACGGAACCAACTTCCACACGTGGAAGTTCAAGATGCAGATGGTGCTCGAGGAGC
GCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTGGAGCACTGCACGACCACGGCGGATCAAGCGACGTTCAAGAGGAAGTCGCGTAAGGCGCTGGC
GATCATCTGTCTCGCGATGGAGGACTCGCAGCTGCCGCTGGTTCGCTCGGCCAAGGACGCGCATGATGCATGGTCAAGACTGGAAGGACACTTCGAGAAG
AAGAGTTTGGCCAACAAGCTCTTTCTTCGTCGGCGTTTCTTCACCACGATGATGGACGAAGGTGATGATGTGCTGGAGCACATCAACAAGCTCAAGACGC
TGGCGGAGCAGCTCGACGCGGTTGGCGCTCCGGTCAGCGAGGACGACTTGGTGATCACGCTTCTGGGCAGTCTGAGCGAGTCGTACCAGTTCCTGATCAC
GGCGTTGGAGTCGAGAGCCGACTCGCTGTCGTGGGAACTCGTGACGTCTCGGCTGCTGCACGAGGACATGAAGCGCAAGGAACAAGGTGGCGGCGGCGTC
GACGGAGCCGCGCACGGCCAAGGTCAAGCGTTCATGACGAGAGACAACAAGCGCAAGGGCCGACCGGTGAAGAAGACCGGCGCGTGCCACAACTGCGGCA
AACAAGGACATTGGATCGCGGAGTGTCCCTCGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCGGGATACCGGTAGGATACCGGTATGACCTTCACTCAGT
GGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTA
CGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAA
TCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCA
AGCGACCAAGCCTTTT