Description :
From Genome Similarity Track
Location :
Scaffold_1401:3256- 10202
Transcript NameFunction/comments
Phyta_totarag12890hypothetical protein
Phyta_totarag12891hypothetical protein

Sequence
6946 bases(100 bases per row)
CCTGGGATCAGATGTGCGACCGAGTGGACGCTCTGTTGGAAACGTGCGATAAATGTAGATCAGCGTGGCGAAGTGCTCCTGGGGAAAGCACAAAGAGGTA
TACCTAGGGCATCGAGTATCGAGTGAAGGCTCGAAGCTGACCCCAATGATCTGACAGCGTTAACTGGTCTACCATTCCCAGTAACGTTGCGAGCTATGCA
ATCGTTCTTAGGCAGTCTGAATTATTATAGTCGTTTCATCGAAGACTATGAAGTCTACGCGGTAGTACTATACGAGCTACGGGAGGTTGATTTcgcggcg
atggcgaaggaTAGTAACCGCGAGCAGATTGAGAGGTCATTCCGAAGATCCGATCTAGACCAAGATCTGGGGGCGCAAAACCTGGAACCTCAGGACGCGG
GAGCATCGGACATGTACGAGATCGACCAGCGATGAATACAAGGCTTTCGCTGCCCTCAAAAGGAAAATCGCGGAGACTCCGATCTTACGTCATTTTGACC
CAGATCACCAaccagtggtggtggtagtgTACGCCAGTGACTGGGCGATCTCAGCCGCTCTGATGCAAGATTACGACGGAGTTTGTCACCCTGTGACTTT
AGATCTGAACGACAACGTGCTGGTAGGAAAACCTATCCGGATCCTGACCCGCCACTCGACGCTGGCATGGCTGTTCCAGTCCCCAGGTCTCCAAGGACGG
CTAGGACAGTGAGAGGCATTGTTGTCCCCATGGACATTGGAGATCGTGAAATGTACCAAGGGTGAAGACGAGATCCGGGGAACACTGGCCGCTAGCATAG
CTCTGAGGTCCGAGGTGGACAGAGCTCTGGTCGCAATTGCTCCGAAAAAGGAACCTCGCCGCTAGATTCAAGCGCCGATCCCGACAGTGCAGGTAAATGA
GTCCCTCTTCGTGGTTAGTTTCGACGGATCAGCCCGGGCCAAAAGAGTGGGGGCGCGTTCGGCGCGATTCTATGGAAACTACCAGAATGGACAGTGATCA
GGGCCAGATCCGGCTATGCCGAGGGTCTGACCGTGAATGAGGCGGAGTACAACGGGCTTCTTCTATGTTGCGATCTACTGAAGGGGATGGAGCGTCGGCG
GCTTATGGTTTGTGGAGACTCTAACTTGATGATCCGACAGGTGAGAGGGGAGATCGATTGTAAAGTGCCCGGACTCATGCTATTAAAACAGAAGGCGCTA
TACCGACTACGGGATCTGGCCAGATCACGAACTAGTACACGTGAAACGCGATTGGAATGAAAATGCAGACAGTCTAGCTAGTGCAGCCCTCCAACGGGGA
AGAGGTATcgaagtggaggaggaaTCAGACCTGCAAGATCTCATCACGCTGAACCGGTTAAGTGATTTCCTGGCGGTTCGATCGGAGGCGCTGATAGCGC
AGATCTCACCCGTTACAACCAGATCTAGAGTCCGAACCCACTTCCGTCCTAAGGTCCTGCAAGAGGAGTTAGTGCGAGATCTCAGGATCGACAGTATCCG
TGAGGCGCAGGACGAAGAGGCGTGGATCTCAGGGCTGAAGAAATATCTGTCTGGAGCCGTGAAAGATCTAGGACAAGCCGAAGCCAGATCTTGTAGTGGT
ATTGCGAACGACTACTAGGTGGACGACCATGATCTACATTTTTACTGCCCACTTTCAAAGAGGTCGGACGAGGATCAGGATGGCTTGATGAGACTGGTGG
TCCCAGAGATACTCCACCGGGATATTCTACATCGTTACCACGTAAGCTTGGATAGTGGCCATCAGGAGATCGGATGTACATATCTGCGCGTCCGGGACCG
TTTTCACTGGAGTGGCCTCTATCGGAGTGTAGAGCAATATGTAGGGGAATGCGTCGATTGCGAGACCGGGAAAGGGAAGCCAACGATCTGGGGTGAATCG
CCCGGGAATATACAAGCGATCTACCCATTCCAGATCGTAGCCATGGATCATATTCTCTCATTGCCTAAATCGTACAAGGGCAATACAGAACTGCTGATCT
GCGTGGATCTGTTCACCAGATACGTGATCGCGAAAGCTAGCACGTCCCGGACGGCCCAAACTATAGACGAGTTTCTACGACGAATGCATATTTCGAAGAT
TTGGGGCTAGTGAGGCGATCCGACACAACCGGGAACCAGATTTCATGTCAGATTTCTTCCGGGCGTTCAATAAGATCTTGGGACAAAGGCAGCGCGCTAC
GATGGCCTACCGGCCCCAAGCCAACGGAACAGCGGAACGCATGGTGCAAACTCTGACGCGCGCTATGTGCAAGATCGGGATCAACGAGATTGGAATGAGT
ATGCCGAACGATTAACGTTCGCGATCAACACAGCCCAGGATCGGATCAGAGGAGACACTCCGTTCTACCTGGTGCATGGATAGGATCCGAGGACTACGTT
GGAAGCCACAATCCCGGTGGGTAGTACCCGACGTCGAAACCGAGATCCACGGAGACAGCGGTACCAGGTCCACAAGAATTACCAGCAGGCGCGAGAACAA
ACTAATGAAAAATTGCGTGAGGCCATCTCAGATTGGGCGGATCAACACAACGAGGGAGTCCAACCCCACCCGATCGAGGCTGGATCCCAAGTCTGGAGCG
GGTCAAGGAAGGTTACGCCCGCAAGCTGGCGCATTTGTGGCGTGGTCCGTTCCGAGTGGTCGAGCAGATCAATGACTTCACCATAAAGTTGGAGATCACA
GGTTCCGGATATCATCTATTTCCTATAGTACACGTTTCCAACCTCAAGTTGGTCAAAGCGTTCCCCGATCGGCCGAAGATCATGCTCAACGTCGAAGGTG
GAGACCGCTTAGATCTCGATGAAGCACTGCTGCCAGAAAATAGCTGGATCCGAGATCTGGTGCTGATGAATACGAAGTGGAGGAAATCACCGATATGAGG
ACCAGTCGAAGGACTAGATATGGCCGGATCCTCCGAGAATTCTTGGTGAAATGGCGGGGATATGAAGATCAGAGCTGggtggatgaagcagatctTAATT
GTGGTGCCCTACTACATGAGGTTTTACGAGATCGCATCAGCCATCACAGGTTCGGTGTGATGCAGTCTCACGAGGAGTAGCGGGGCCGTGACCGATCAGG
ATGAGTTGGTCGTTCTAGAAGAAGGATCTGCGAGGAGGTCGCAGATCGGAGGAAAGAGGTTATAcatatgtacatgtaagacTCAACATGGGAGACCAGA
TCTCCAAAACCGGATCCGGAGATATAAGAGAAGATGGCAAGAAGAGGAAAATCGAGATATTAAGAGGAGTCATCGAGTTACGCTACGGTCATATTACTAG
AGTCGGGATCAGGAGGCGGGCGAAACCTAGCGACGGATCCAGaccgaagaagatgaagttcCTCACAGCTTCGCCTCCCCAGAGCTCTGAGATACGTTGA
AGAACTTACCTGCCAAGCGTAGTCCGGTGAGAAGGGTGAGTGTCACGGAAGTGGTTGCGCCACAGGTCTGCATTACTGCATTCATCCAGAGCCTCCAAGA
GATCCGCGGGTTCGACACGGTTCAGAGTCGGATCCGCCAAGTTGGCCGACCGCGACACAATACCCAGGTACCACTTCACCGACTCTGTCCGACAGGGGAG
TGGAGGATGAATAGATCCAGCAACACACCCAGATCACACCAGCTTCCCGCATGACAGTGATCAGAACCCAGACCAAGCGTTTCCACGCACTCCCCGCGTG
GAAGCGACGGTTCGTACGTTCCTCCCGGAACTGAAGATGCCACGGATCCGAATCTCGTAACGCAGTGGGGATGGGGAAGGAGTGGGTGGACTCCCAAAAG
GCTTGTAGGAGATCCGCCTCCAACGTCTGGTACTCTTCCACGAAGAGACCAAAACTCCCTCCCACATCGCGGCGGAATGAGATCAGATCCCGAGAGTTCT
AAAACAAAACCCAGGGTTTGGAGTCATATAAAGCCTCCACATGAGCCCGGGTGACCAGATCAGGGCGATAGTGGGTCCCAGGTGGAGTTGGCTCGTGTGG
GCGGCGGGCAGGATACAACCATCCTGCCTCCACATGATGCGCTGGGAAGATGGCAGCGGTCGTCAGGGTGCAGATCGCCAGCCGGTTGACCAAAGCCGGG
ACCCACGGAgccacttgagcagcagtcagGACGTGGGACCGAGCATAACCCGGTATACAGGTGTTGCTGGGACCAAACGGAGCCGCCGGAGGATTCAGGT
TGCTCGCCCCACCGTGGTAGGTGTAGCCGCCCGACTGGCAGTCCGGGCGAGTGTACGGCGAGGCGCAGGTTTAGCAGAAGCGGGATCAGATCCAGACGGT
AAGGGCACTGAGGGGCCCTGCCCCGATCCGCCGCTAGATCCATTCACATCCAGCGGGGCCTCGGCACTAACCCTGGTGGCGGACTGGTGATCCCGACGAG
CCTGTGAACGTGACTGCGACAGAGCCATCAGCGTCtgttcctccagctcctcttcttTGTCAGAGGACAGCAGAACAGAGCTGGGTCCATGGGCACTAGG
ATCTGGGGTAGATCCACCACCAGATTAACTGTCGTCATCGCTTGGATCTGAGCGATGGTGAGATCCGTCAGACTCAGGATCGTTGGAGTAAGAGTCAGAT
CCGGAGTTGTCGGGATCTCCACCTCCGCCCGTCGGGGGTTGAGTGCGAGAACCAGCCCAACCCGACGCCGtataccccccccccccccaacgcGATCAAG
ATCGGCGGGAAGATCTGACCCGTGAGCTGGATCGGGAGAACCacagccgtcgtcgtcgatctccggCTGATCCGTGTCAGCCTCGGCCCGGTCCAACGGC
ACTGACGACTGTTCGGGAGAAGAGGCGGGACCGAGACGGCGGAGATTGCGATGAGACATAGTAGTGGGGGCCGGAGAGGAAGAGCGGCTGCGAGGATGCT
TAGATGTCTTGGAATCCGAAGACCCACTCGCACGCGGATCCGAAGGCCCCATCACACGCTGATCTGGAGGCAGACCTGGCTGAGATCTAGGGGTGTCCTG
AACCGGCGGACGTACACTCGTAGCACTCCCAGAAGCTCCCGGCGGGGGAATTGCCCGCTTATCACCGAAGCCACAGCAGGCATCCGCTGCAAGGCAGCCG
AATGGTCGGCAGTCGCAGCCTGTAACTTCTGTTGAAGGACCTCTCGCTCCCTCACCATCTGACACGATGGCGCTCAGCAGAAGACGGGTCTTCTCGTAAC
CCAGTGGAAATTTGCCGGGCGTCCGTCAGTTTAGTTCCTGTATGCAAGTCGTGGGTTAGCTCCAGATCAACGAGAAATCCATGATAAGAAACTCCAGATC
AAGTAACTTACGAAGCTCGGAGACCTCCTGGGCTTCGGATCGGGCGGCATCGCTGTTTGATCCCCTCCGCGAGAGTCTCTAGCGCCTGGCCAAGATCCCG
GTCCAGATCCACGGCTCTAGCCGATTGTAGAGCACGGTCCTTGGTGGCTTGAGCGAGAAGCCTCTGGGCCACATCCCGTTCCTGACAGACCTTTACCATG
TGCTTGGTCAGAGCCTGGATCTCTTCATGCGCCCGATCTCGCTCCTTCGTCACTGCCGCCAAGTTGGACGTGGACGGCAAAGGAACAACATCAGACGCCG
AGTGGTCAGATTGGGGAGGTCCAGCGGGGGTCACGGAGTGGGTCGGAAGAGCCACCGCCGGAGGGACGGCCAAAGCCGAAGATCCAGACTGGAGATCCGA
GACCTCAGCCTCTGTCCGTTGGAGATCGACCCGCGTCCGATCCAAACTGCCCTCCGACGCCTGAAGCAGGGCTTGCGCGTCGTCTCGGGCCTGCTCTGCC
GCGTAAAGTTggtcttggagctggaagtagtcttggagctggaagtagTCTTGGTTAGAGATCCGCAGCATGTCAGACAGATACTCGTGATCTGAGGCCA
GCTCAGATCGGCGTCGCTCCGAGTCCCGGAGTTGCTGCGTAAGACCGTCGATCTCGGCATCCTGACGATGGACTCGGTCTTGCCATTCCTGTACCGTCGA
ATGGGTGTCATGTGCGTCCCGGAGCGCATCGACATGACCTCGAAGATCCTGGCTTTCCCCCAGCTGCTCATCATGAGTCCGGGTTAGATCCCTGTGATCT
TGGGTGAGGCGGAGTAGAACGTGGTTATCCTGCTCACGGGCGCTGATGGCATCATCGCGAGCTACGCGTATGGTTAACACGGTATGCTCCAGCTGAGTGA
TGCGCGACACCAAACGGTTGATGTGccacatcaacttctgcCTAGAAGAGCCGGCAAGCTTGCCCGACGACATCACGGGAGGCTGCGGAGCCTTGGGCGG
CTGATTGGGGGACGATCCGCCGCCGGCAGACGAAGCGGGGCCAGTTTGGGACAACTGGAAAGTAAGGAGGTTGCGGAAATGTTGAAGTGTGCGCGCAGCG
ATACCGTTGGGTGACAACAGCTGCACGCTGGAGGCGgttgtggtgaagcactttTCGAAGTGACACGCAAAAGATGGATGGGAAACGAAGTAAATCACTA
ACCCGGATTAGTGACATCCCGGATAAGGAGTCGTGGGCATGACCAGCAACTTTGTCCAAAGTCACTTCCGGAACAAGGACTTAGCTCTAGAGGGGAAGTT
TACGTAGTTCAAGCGAGGAggatctgatctacatcgGAGATATAGATCCGAGATCCGGGATCGAGGTGGATCTGATCTACACCGCAGATCTAGATCCGAG
ATCTAAGATCAGGACATATCTCAGAGATGGGAAGAAGGTAGCGACTTAGTGTAGAGGTTGTGAGGATATGAGTTTGGGATGGGATAGGCTTAACCGTGAA
TTAGAGTTGAGTTTGCATTGGAACACACAAGTGCCTTGCTACGCCAGGAACAGGGAACATATATTGGCCTTAGAAGGTGTTGGCAGAAAAGGAGTGAGAG
AACTAGTGGAGTGTAAGATCTAGATAATATATTGGCCAGCTCTTCC