Description :
From Genome Similarity Track
Location :
Scaffold_38:325535- 334249
Transcript NameFunction/comments
Phyra_95347Hypothetical protein
Phyra_79262U2 small nuclear ribonucleoprotein A', putative
Phyra_95351conserved unknown protein
Phyra_79264Hypothetical protein
Phyra_79265kelch motif family protein, putative
Phyra_71692unnamed protein product

Sequence
8714 bases(100 bases per row)
CGAGCTGGGCCAAGCTGGCGCCTGGAAGAGCTGCAGATATGACGGGGGACTCGCCACGCACCAGCTTCGGCACGCTCATCCTACTACGCCACGGCCAGAG
CGTGTGGAACCGCAAGCCAGACCGACCCTCGGATCTCTGGCGCTACGCGGGCTCCATCGATATTCCCTTAAGGTGAAGAGATACTGAGAGGGTTACTCTG
TAGTGAATAGGTTACTAAACTGTGGTGAGTATTGGACAGTGAGGTGGGCATGCAAGAAGCTTTTGAGGCCGGGAAGAGGCTGGAATTCGTGCCAATCGAC
GTGGTGTTCTGCTCGCAGATGGACCGAGCTCGCACGACCATGTCACTGGCTTTGAGTGTGCACTCGAGCAGGAAGACTCCGGTAGTAGAACATCGCTCAC
CGCTGGATAAACCAGCCTTTGAGGGGGTGAACGACAAGAACCCCTATGACTTTGTACGTGACTTGGTGGGATATCTGCATCTGGTGGTTTGACGTTGAAG
CTGACCTGTTGCAGATCATCCCGGTATATGTATCGCCGACGCTGAATGAGCGCAACTTTGGTGACCTGCAGGTTTGTGTTGTGTCCGAGGCGTTCGTTGA
GAGGGAGAGATGCTAACTTTTGGCTGATAATGTAGGGTGTACCAAGCACGAAGCACACTGTGATGTTCAATAGAGAGCACGTGAAGAAGATCCGAAACGA
CTACTACACGCGATTCCCTGGAGAGAACGGTGAAAGCTGTGCGGATATCCACAACCGGACAATCCCGTTCTTCAACTCGTTTATCCTACCGCATCTTGCT
GCGGGGCGCAATGTGTTGGTGTCCTCTCACGGGTTTGTCATCCGGACGCTCATAAAATACCTGGATGGCATGGATGCAAAAGAGTTCAACGATCAGATGA
AGCTGGAGAAGTCAGCACCTGATAAGTGCCTGCTGCTTGCCCCGACGGGTATGATATGCTTCCTGGGTTTGAATACCGTGCTGGGCGGTGTCTAACCTTG
TAGCTCGTGCTTTTCTACCCAGGTGTTCCACTCATGTATAAATGCGACAAAGGGAAGTTTACTAAGATCGCGCAGACACGCCGCGACCGCGCTGAGAGTC
TAAGCCGCAGCATTGCGCCGTACTAGATGATTGCAGTGCAAGCTGCACTCTTGCGTTACGGTTGCCTGGTTTCTCTAGGTAGATTATTGTGCTTTATTCA
AGCATGAGCGGCAGGCTGGCTGATTTACAGTGCACTTTACTTTTTGCGGAAAAAGTGACAAGAGCAAGGTGGGGTTCAAAATAATAACCGGCGCCATGGA
GGGTCAAGGTCGGGTTGCTTATTTGCATCGGTGCTAGCATCTTCGCGATTCAGCATTGCTGGCTCTGTTTTCTATCTCCTATCTGCTGGCAAGCGTGGAG
TTTTACTGGGGATGAACGACATCAAGCTTCTCCCGCAGCTTCTTTCAAGCGCTGCACCAGCTCAGCCTTCAAGCCCTTGATGGGCAGGCCGAGCTTCTTC
AGTTCCTCTCGAAGAATACTCACAGTCATCTGATCAATCGGCTTCGGCGGCGTGTATGATACGGTAGCCTCCTCCTCGCTTGCATCCTCCATTTCCACAT
CAGCCTGTGCAGGTTCTTTTTCCGGTGCTGGTGTTTCCTCCATCGGCTCCGCTCTAGAAGCTTTCTTCGGCGACTTGGTCTTGACTGCAACCTCCTTCTT
CGGCGAAGCAGGAGCACGCGGTGGAGGAGGAGCGGGCACTGCGCTCGCTTTGGGAGCGTGCTGCTGTGCGATCGAGACCTTTTCCATCGCCTGTGTTGAC
TCTACCACGCTTTCGCCGTGGGCCTCTTTCTCGACCCTCTGCCCGACAACCGACTGGAAAAACGCGTTTGCCGCCTCACGGTCCTGTTCCCAGCAAAAAC
CAGCCAACACGGTTAGAACTCCCTCCTCACTCTAGCCAAAAGGCGATCACGACTACGTACACGAGGACGGATCCGCTGGAAGTCGAGAACATGCAGCTGC
GGCAGCTTGTAGATGACGTACTCTCTGTAGTACTTGCGTTTGGTCACGGGGTTCCCGCTGAGCGAGAGCGTGTCCAGCTTGGCCAAGCAGGCTAGATGGT
CGACCTCTGCCAGCTGCGCAATGCGGTTGCCCGTGAGCATCAAGAACTCCAAGTTGGCCACAGCCTCCGACAGATTCTCCTGGATTTTGGACACGTGGTT
GTTGTGCAGCAGCAGCATGCGCAGTCGACGCAGCCGCGGAAAGTTCTCAAGTTTCTTGATCTCATTGTCCGAGAGGTCGATGCAGTCGAAACCATCCTAC
CACACAGCATCAGAGTGAGATCCCGAGTCTTCTCTACGTTGAACAGCCACTGGGTGGCAGAGGACGCGTCATAAAGAGAGCAAAGTCGCTACCTGGGTGA
CGCCCAAGTTCTCGATGGCGGGGGCCTTGCAACCTGCGACATCGTCAGTAACCGGTAACTATGCAGCAAGCAGACACGCGGGGAGGTACCTCGAAGGTTC
AGCTCGCGCTCACGCAGCGGGTTGATGGACACCTGCGCCCGCAGAATCACGTCTGCCGTCAGCCGCATCGCTCGCGTCGGGGATCTCTCACTGCGTGCTC
CACTCCAAGGCAGCAACGACGCGATTGGTCGAAATGGAAATCAAAATTATACCGGTCGAATGTCAATTATAGGTTACACTTTATTCAGGGGTTATACGCG
TTCTAAAACGAGGGGTACACTGTATCAAGACGCTCGGGCACTTCGAGGCATGACGCCGAGCTCGATGTCGTCGTAGGAATCGTCCGTGATGGGCTCCTTG
GGTCTAGACAGCGAGAGCGTGAGATTGCGGATGCTGCTGGGCTTGGCTGCCTTGGCGCTGGGGACGTCGTCCTCGTCGCCGTCGACCAGATCCGCGTCGT
CCGTGCTGATGGCCACATCCGCCGACGAATCTGCTGCGCCGTGCGCACGTCGGTGCTCGCGTCGGATCCGGATCATCTCTGGGGTGTGCACGAAGAAGAA
GACGCCGACGCAGAAGAGCGCGATGAGGTGTGCGCTCACGAGGTTGGGGAAGAAGCACGTGTCGTGGTTGCGGTCCGACGGATACGCGTACACCCAGAAG
TCGTACATGACGAAGATCGGCAGCGCCGTGCGCGAGATGCCCCAGATGATATATGTGCTATAGATGGAGCGCATGTAGTTCTTGGTGTCCTGGCGGTCTC
TGGCGTCCATGAAACCCCGCGCGTTGAGCGGCAGCGTCGCGAGCTCCACAAGCAGGAACAGCAGCAGTCCGAATTGACAGGCGGCGCAGCACGAGATGAA
GTTGTTGATGAAGTATGGGACGCTGTGAAGCATATTACACTGTCAGTTTGATGGTTCCTCAAGATAGTGTTCGCAGAGTACGTACACTGCGACGATGTGG
TGGATGATGAAGACCCATTGCATCGGCACCGGCCAGATAATAATGATCATCAGGTCGCAGACGAAATAGCCGATTGCTGCACAGTATCACAAGCAACGCA
ACAGAGAGGAAAGTTAGCGGTTTGCCCCACATTGAATCAATCGACCAAGACCACGAAAATGCCGTACCGATCGAGAAGATGAAGCTTGCTGCGCGAAGCG
ACGACATGGGCATGAACCCGCTCGCCCAGCTAATGTCCGCCAGCGCGTAGGCCACGCCGACGACGACCAGCACTGCGTGGATCGTCGAGTTTACTCTGTT
TCGACCCCAGTACATCGTAAAAGTGAGTTCGCTGTCACACACGCAGCAAACTCAGACAGAACCCACCGTGAGCACCAGTCGGCCTTCTGCCCGGGCGTGA
AGCTAGCAAACTCTGGGATGCGGCGACTAGAGAGAAGCCACGAGAGCCCGAAGTTGGCCCAGAACAGTGCGAAGGCGATGCCCGCGACCAGCACGTTCTC
GCCGAGGCGCACGCTGCGCTCCTCCTCCAACAGCTCGTCGCCGCCATCGTACCATCCCATGCTGTCAATGTGGCAGTGCGCGTGTCAAACGATTCCAGCT
GCTGCTGATGGCAAGTGTCGAGCTCCGCGCAGAAGGGAAGATGGAGGGACGACCGGATGACGCCAACGCAGGAGCAAGTCAGAATCCACCGGTGGTCTCG
CACCGTGTGTCGCTTCGCTGGACACACTTGTCTCTATTCGTTTTCGAAGACAATTCGGCTACCTACTTCAAATGTATTTGAGAGCCGTTTGAGGAGGGTA
CTATTTTCAACAGGCGTAAATTGTAAACGAGAGGGATGGGACATGCCACGGTACAGCGAATCAAAACGCCTATCCGACGTATTACTCACGCCATTGGCTG
TATGACGGCGCACGTTCATTGGTCAAAACAAACTGTATTTACGCGCCCGGCTCTGGTAGTCGTCGCGACGTTAAATGCACTGCTAAATCGGGGTTCCACT
GCTATTGTCTTACAAACATCAAGTCATCCGCTCGCCAAACGGGACTTTCAAGTCCGAGTGCTAAATCAGAGCGTGACTCCAAGTCGAGCGAGCAGATCAT
CATCATCCTCGACTTTCTGGTCGTCTGCCACGGCGCTCGCGTTCGAGCTCGCCGATGCCGGCCACGCCTGCGCCTGCAAATTCTCGGTCGTCGCCGTCGC
CCAGCCGCTGTCCGTCTTGGCGGTCGCCTTCATCTCGGGCCACAACGCCTCGACCGGTGGCTCCGCGATCTTGTTGGCGTTTACCGCCGGTGCCGCGGCC
TTGACCACCCAACCGGAGGCCGCGGACGTCAAGCCAGGCGGCGGACGCAACACGCGCGACGCCGCGCGAGGCTGGAAACCGGGCGGGACGCTCGGCGGCG
GTGACGCCGTAGACGCCAACAGACTGCTGCTGCTGAGCTGCATTGCCGACATGCTGCCTCGGCGCGGCCGCTGTTGCTTCTTGCCCCGAACTTGAGTTGA
AGCCCGCGGATTACGACGCACAGAGTGGGATGGCGCTGCGGAAGAAGCTAAAGCACTGGAGCTCTCGAGAGTCTCGTCACATGACGAGCGTCGGCGAATG
ACCGTGTAACCCGCAGCGTCCGCTTCGTCCTCAGCAGTAGCGGGGACGTCTCCGCCTGCTTTGCTGGCGCACTGCTTGGCGTGTCGGTTCTTGGATCGTC
CTGCACTTTCTCCAGAGCGGAGTTGCTGCTGGTGTTGGTGACTGCTGCTATTGCTGCGACGCTTGATCACGTACCCGCCGGGCTCTTCCTTCACTTGGCC
AGAGCTCTCCAGTGCTTCGCGCATGGAGCTGAACAGCGGACGGCGATGCGGAGGCGCCACCTTGTCCCTATCATTTGCATACGTATCGGAAGGCGGCGTA
GATTGCTTGTTGACGCTGGAGACCGAGTCTTGACGCTCGCGGGTAGCGACAACATTGGTTTCCACGTCGTCGTCGTCTTGCAAGACCATAGTGCTGATCT
GCTTCGACACAGTGGCAGCGCCACTTTCTGTTGATGTTGTGTCGGCAGCGGGGTCTGCCATCTCTGCGCGTCCAATTCAAGACTGAGAATCAATACATAA
GCGCGAGCTCCGATCCTAACGTTACTTGCCTTTCTCCCATGTGCGAGACGGCGAGAGAATCGCAGCAAACAAGAAAGGGGACGTCTAGCAAGAAAACCTA
ACGGTGCCATCCACAGCGTTTGCAGTTCGGCCGACGTGTTGCCAAACCTGCCTGCGAACACTGAAGACCGCTCCGCCAGCGAACCGACGCGTTATACGAA
CTTGTCGATTTTCGGACCGCGGAGCGGCCCCCAGCTTGGGACGAGAGCGTTGAGACCTTCTTGTCGAGTCCATGTCGGCTCCGGCCGCCGCGGCAAGAGA
GAAAAGCCACACGGAAGGCGTTGTTTCAGACCGGCTGCGTGAGTGCGCGGATCTGTGCATGTATGTGGAGAAACTCGACTTCCATCGAAACCAAGCCCCG
AATTTCGTGTGCGACTCGTACCGCAAGATCAAATGGGTAAGAGAAAAGCAGCGTCGCCGTCTTGAAGCTCTTCAACAGCAACAAGATGATTCTCACAGTG
ATACGCAAGCCAATGCTCCCAATGAAGTTGCTGAGTCTTCCTTGGTCGCAGCAGATGGGACCAACAACGAACAAGAAGGCTCACTTGACAGCCTCACCGA
ATCCTGCGATGATCCGCTCGATGTTCTTGTGGGTGACGTTCTACGGGGTTACAACTTGTCTGTGACCTGCCGTGGTGCGCTACCTGCACGTGGATCAGAT
CCGCTGGAAACCATCTCGATTCCTTGCATACGCGAAGGAAACTCGCTCACACTGTGCTCTTCTGCCACGATTGGTGGTCAGCTCGTGGTGTTTGGTGGCC
GCGTACTTCGTGACACATCCATCTTGCTTCCACGTGCTGTTCGAGTGGATCCGATGCAGCTTGAGCGAACTCGGTACACCTACTCAAACAGCGTCTATAG
CTTCGACGTCGCCACGAACACATGGACTCGTCGGGAGTGCTCTGGGCGAGAACCGCGTGAGCGGAGTGATCACTCGGCGCTGTTCATGGAGCCTCACCAC
CTATTGATATTCGGCGGGCGTGGTCGCAACGGCCAAGTGTTTCGAGACTTCTTCGCGCTCTCTCTTGAGTTGTGGCACTGGACGCAGCTCGACATGTCGG
CGACTCCGTATGAGCGCTATTGGCATGGATGGTGCATCGCCTTCGATACCGACCAGCCATGGCAGCAAGAACCAAGCGTCTTTTTGTTTGGCGGCAAGTC
GGACATACTTGTCTACAGCGACTTGCATCAATTGCAGACCACGCGTTTGAAGCGCCTGCTGTTTGACGAGGAAGAGCACCAGAGAAAGAATTCCAGCATC
AACGACGGAGTGGCCACCACACAGAGGATGGAGGAGCGAAGAGTAAGCGATGCATCCCGACTGGTCATGAAGGAGCGCGAGCGGCAGCGACTTCCAGCCT
GGTTTGTTCCGAACACCGTTGGGAAGCCTCCGTCAGCGCGCTTCGGCATGCAAGTGGTTGCACTGGAGAACGAGCAGCTCGCAGTGATCGGCGGGTGGCG
CATCTCCAAAAGCAAGCGCTTCGACAAGACTGGCAAGAGCCACTCACTTGCTGTGCACATCCTTGACCTGACGATTCTCGTATGGTCAACGCCGAAGCTG
TCGACGCTGGTGTGCGCGCAGCCGTCCGTCCCGAGCGAGCGTCTGCTGTTCGAGTGCTTCTACGTGAATCAGACGCTCGTACTCTTCGGTGGGCACACGT
ACACGTACAATGGAGAGACCGAGGCGTTCACTGCGTGCGAAGACGCGTCTACAGTGCTGTACAAGTTGGACGTGGGTCGCATGATCTGGCGCCGGCAAAA
GTTCCCAGCAGCGGGCAATGTTGACGACGAGTCTGTCGTTGCACTTCCCATTGCGCACTCGCACGGAAGCAGCAACGCGGTGCTGAACGGCCGAGCCTTC
ACGTGTTCGTCCGAGCCCGATCGTCTGCAGCTTCAAGTCACCGCCCTCGACATCCGAGCTCATCGGCCAGGTAGATAACATTCTCGTGATGCACGTCAAG
CCCGGTCGCTGATCGTCAGGCACCTTTTCTTGTGGCTGTGGCGTCCCTGCTTTTCCACCAATGCGCAAACTGCTTGAAGCGCAGCGCCAATCGAAATGTT
GCCACACCACCCACACACAAACCAGAACCCTACACACCACCTATACCCAAAATGGTCAATACAAAAACTAAGCTAAGCGTTTGCGCAGTCAACTGTACGG
ACTTTGCAATACTGTTCACAGCAACGCCGATTCTGGTGTGGCGACCACCGCCAGCAGCTCCAAGCTCAGATCCAGATTAGCGTAGTCCTCTGCAGACCAT
GTTGAGAGCTCGCCAGCTTTCCCGCGCCCTGCGCGCCGCCGCCAAGAAGCAGCAGACGCGCCGCACCTTCTCGTCCGCCGCCCGCGGACTGCAGACGCCT
GTGGCCGCCGCGCTGGACAACACGCGTGAGTTGTCCACCGCCAAGGCGCAGGAGGAGCACAAGCGCTCGCCGCCCAAGACCACCGACAAGTTCATAGGCA
AGACGGGCGCCGAGATTTTCCACGAGACGTTGGCGGAGATGGACGTGGACTGCGTCTTCGGCTACCCGGGCGGCGCCATCCTGCCGGTGTTCGACGCCAT
CCACGAGAGCGACAAGTTCGACTTCGTCCTCACGCGCCACGAGCAGGGCGCCGGCCACATGGCGCAGGGATACGCTCGCGCCACGGGCAAGCCAGGCGTC
GTGCTGGTGACCTCTGGACCTGGAGCCACCAACACCATCACGCCGCTGCAGGACGCGCTCATGGACGGTACCCCCATCGTGGTTTTCAGTGGCCAGGTAG
CCACCCAGGTTCTGGGCACGGACGCCTTCCAGGAGGCCGACATCTTGGGTATCACCCGCCCGTGCACCAAGTGGAACGTGCAGGTGCGCGACGTGCGCGA
CCTGGCCCGCAACATCCGCGAGGCATTTCACATCGCCACGACCGGTCGCCCGGGCCCCGTGCTCGTAGATCTCCCCAAGGACATCACTGCCGGTCTGTGC
AAGAGCCCCGTCGTCACGGAGCCGCAGCTTCTCGGCTACTACGGCGAGAAGAAGATCGAGGGCAACCGCGTGAACCAGGACGCCAACCTGGCGGCGGCCG
TCAAGATGATCAACAAGGCAAAGAAACCGCTCATCTTCGCGGGTGCCGGTGCTCTACACGCCAGCGAGGAGCTCCGTGCCCTTGCACGCCAGGCGAACAT
CCCCGTGACCACGT