Description :
From Genome Similarity Track
Location :
scaffold_4:325535- 327224
Sequence
1689 bases(100 bases per row)
TGCCCCAGGATTGGAGGTGCGTCATGCAATTCAATTGATTCCGAAGCTTCATTCTGCGCCAAACATCAATGGTTCTTAAGATTGGATAGTGCGACGTCAC
TAACGTCTTCTTGCGTGCAAAAGCGCGAAGCGGATTTATGTGACTGAAGGTTATTTGCACTCAGCACCAACGCTCTGTGCCATTAACGATGACTCGGGGT
ATCGTgcatgcttataataagccaTATTTCGGCACAATTGCCAATCCCCATAGAGCATGTGCTGCAGAACTGCACGGTCGGTTGCACCTTCTTTAGCGTG
CTTGACCTTATTAATGACTATTATTCATTGATCCAATTAAATATCGGTGTCCCACTGACCGCGGTGAGTACTACTACTCCAAGCAGGATGCTCGGATAAT
GGCTGGAAAAGTCACAGGAACTATTCGGCAAATTAGCGACGCTCAATTGTCTTGTAACGTGGCTGCTAAGTCTACATCGTGCCAATGCACAATCCAAATC
AACTCAATATTCGTCCATAGTTGTGTAGGGACGTTTAATCGGTTGTGGGCATCCACATTGAACAATTGCAAGAAGCGTAAAATCTCAAAATGCGGTTCAC
CATCATAGATAGGCTCGTCGTTGACGCCAACGAAATATTACATAGTGAGTGGGCAGATTCGTCAAAACTTTTGGCCATCGAGGATTTGCCAGTGCCTAAG
TttcaaaaaaagtttttaaagtggcttggtcgagtcacaacttgcacaagtagcaATCCTGATCGCCATTTCACGTCGTCTGTGTTGCCTCAACTGTACC
CTAGGCTGTGCTGATCTACAAGCTGAGTCAACGGGAATGAACGCGTCATTGCGTTCGTGTATTGCCCGCCTATGGCAACAATGATGACTCTTCCAGCTTA
TAAGAAGGAGATGTTTGCAACAAGGTGTGTCCTAATCAACTTCAAGTAGGCTTCAAGTCATTTATAACCTATTCTACCGATCAAGCATCTTGTTGCGTAA
AAAGCGTCGTTACCACCCCATCTTTCACAAAGTACGACAAAATGATTGTCGTCTCTACCGATTATATTTATGTGGTACGGTATAAGCTAATCGGCTACAT
ATAGTGGCCGATGGGCTTTCGCGTCGCTTGACTATGAGCTGTCGCATGTTGCGATGTTGACAAAGTGCATTTATGGGGTGATACGTATGGCGTACGGACC
AGCGTGTGTTGTGCCGCTGAATCTTTGATAGGCAAGAAGATTGGGAGCTCAGATGCTGCTTTGACGAATTGCGCGGTTGCACGTTTGCACCGCTAGTCCT
TATCCGAAGTATTGTTGTATCCTAGTACTAACCCATTAGACACTCAAAGCGTAGTGGGTGTTTATGATGAGGACTCTACGTACAAAATATTGCATGATAC
TCATATTTATCTTCAGTTGGCCACCGCGAAAGAGAAAATATGTAATACCCGTTACTGGTGTTACATGTATGAGTGGGTAAGCAACATTGTGCAAACGTGT
GATTCGTACCAATGAGTTGCACCCTCGCCGCCTGCGAGATCACCTTTGTCTTGCTTGATGATTCCGGTAGAGTGTGGACAGTCCACAGGTATGGAGTTTT
CAAAATATGCGTTGGCAATATTGGCTTTCGGATTTTTGTGTCTGTCGGAGTGAGAGGGCTCAATTTGCTGCTCTGTTTTTCCTTTTTAA