Description :
From Genome Similarity Track
Location :
Scaffold_31:325487- 331093
Transcript NameFunction/comments
Phyci_6167diacylglycerol O-acyltransferase, putative
Phyci_221503diacylglycerol O-acyltransferase, putative

Sequence
5606 bases(100 bases per row)
GAACGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGCGCGACGCTGCTGGCGCTGGCGTCCGAGTACACGCGCGTGTTCCCGCACCCGTCGGG
CAGCAGTGTGGGGTATCCGATGGCGACCGGGCTGGGCTCCCTCGCTCTGTTTGTGACGGCGCTCTTCAACACATATGGTCTCGGCGGTGTGCTATCGACG
AAGGATGGCTGGAACTTCTATCAGCCGTTCATGGGTGGAGCTCGGTTCGTGCTGTTCCAGATTGTGTCATGGACGTGCTTTGGTGCTGGTGCCGCACTGC
AGGTGCTTTACTTGCTGTCGCTGGTGGTCGTGGAGCTGGAGCTGTTCGTTGGTGCAATGGCCGTGGCAGGATCGCTGTTTGTGGTGGCGGAGATCGGGAT
GATGATGTCGTTGTTGGTGTTCAGGAAGGCTGGCCAGTCGCCGAAGAGAGCTGAGGGCATTGCACGAACTGCTGCTGAAAAGTCGGAGATTGATACGAAG
ACGCCTGAAGATGAGGCGACGTCATCTGAAGAAGTGAGTTCAGCTTCATCGTCTTCGGTGCAGGCTGGCTTTTTGGGTTttcacgaacgccttcgcgact
tcgcagatgagtgccttgcagtgctggttattggtggcttggccaacatccagtttattccgaatgctctgATGTTTGTGTTCTTCGCAGTCACCACAAA
TTTGAGCCCCGCTGGTGTCGCCTTCTACGGCATGGCGGCTACCGGAATGGAGTTTATCATGGTGGTTTCTCGCTCAATCTCGACTCACTTGTACTTGAAG
GATTCAAACAACGGTCTGCGGAAGGAGGTGAATCGCTACCATGTGAAGTACGTGCTGCCCCAGATCGTTACGGGATGTCTTCCGGCTGTAGCCACGTACC
GCCACTTCATCTACGACATGGAGGCATTTGTCCCCGTGCTTCTCCTAACAATCTTCGTTTACATTTATGAATTTACGTACCGCGGCAACCCTCAGCAAAC
TGGATGTCGGGAGCGCGCAAGCTGGGTTACTGGCCGCAGCATGCTGATCGATACGGTCAAGCGCTACTTCAGTGGCAATATCATTCGGATGGCACCACTT
GACCCAGAAAAGCAGTATGTCTTGAGCTTCCACCCGCACGGAATCATGCCAATCTCGGTGATGTGGCTCCAGTTCACGGCGCAATGGCGCAAGTTGTTCC
CGAACTTCTACGCGCACATTCTAACGGCGAGTATCCTGCATCAAATTCCGCTCGCCCGCGATGTGCTCCACTTTTACGGCTCACGCGAAGTGACCCGACA
AGCGTTCGCGTATACGCTTAAACAAAAGGAAAGTGTTCTGCTAGTACCCGGAGGCCAAGCGGAGATGCTGGAACAACAGTCTGCGAAGAACGAGGTTCGC
GTGTATACTCACCACAAAGGATTTATCCGTCTTGCCATCGAGCACGGCGTGCCGCTGGTCCCCGTGCTGAGTTTCAAAGAGGGCGAAATGATGGATAACG
TCCAGGCACCAATGCTGCAGCGCTGGTTCGTCAAGAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGCGGCCTTCACGCTGTTCGCCATCGCCGAGCTCACGCACCACCACCC
GCGCTTCCTGCTGGCCGACGTGCTGCAGGGCGACACGCACCTCGCGGCGCAGTGGGCGCTGCTGCTGGCCGTGCCCGCCACCAGCGCCGCCGCGTGGTTC
CCCATCTCCATCTCGCACGCGCCGCGCGGCGTGCTGCGCATCAcgtcgtcggtgccgccgccgtcgcccgactcgccggcgctgtcgctgtcgccgtcgg
cgtcggcgtcgctgctgGCCAGGCTGGCGAGGCGCTACCGCCGCAACCACATGTTCGCCATCTACCAGAGCGTGGGCTGGACGCTGTACGCGCTGTTCGT
GGGTCTGCAGCTCGTGTGCTTCGGGTCCGACAGCGTGCGCGACCTGCCGTTCTGCAGACCCGGCAGCCGCTCCGTGCAGGCCGTGGCGGCGTTCATCGCC
GAGGTGCTCATCATTTCGTCGGTGCTGACGCTCGAGAAGCGCCGCGACCGCAATCGCCAGCGGCGGAAGGACCGGTTCGTGGTGCAGCTCAACAACTTCA
ACAACATGTTGTTGCTGGTGGGCGCGACGCTGCTGGCGCTGGCGTCCGAGTACACGCGCGTGTTCCCGCACCCGTCGGGCAGCAGTGTGGGGTATCCGAT
GGCGACCGGGCTAGGCTCACTTGGACTATTCATCACAGCACTGTTCAACACATACAACCTCGGAGGTTTGCTGTCCACGAAGGATGGCTGGAACTTCTAT
CAACCATTCACGGGCGGCGGCCGTTTTGTGCTGATCCAGATTGTGTCGTGGTCATGCTTTGCCGCTGGAATGGGGTTGCAGTTATTGTATTTGATCTCGC
TCGTGGTGGTGGAGCTGGAGCTGTTTGTGGGCATCATGGCCGTGGCAGGATTGTTGTTTGTCGTGGCGGAGATTGGGATGATGGTGTCGTTGCTGGTGTT
CAGGAAGTCTGTTGACGTTGAGCCTACTGCTGATCAAACTTTGAATGGGGCTCAGACTTCCGTTAAAGGAGGCAAACAGAACGATACTCCAACCACGGCT
AAGTCATCCCCTCGTAACTCGAACTTCCATGAGAGCTTGCGTCACTTCGCCGATGACTGTCTTGGCGTGCTGGTTATCAGTTGTCTGACCAACAACTTTG
TAATCCCGAACGTCCTGGTATTTCTGCTTTTCGCGCTGACAACGGACTTAAGTCGAGAGGATGTCGGCATGTACGGATTTTTCGCGTGGGGTATCGAGGC
GGCCATGATGACATCGCGCTCAATTGCAAACATGTTGTACTTGAAGGATTCGCACAACGGTCTTCGGAAGGAGGTGAATCGAAGCGATGTCAAGTATATA
TTGCCCCAGATTGTCACGGGTTGCCTTCCAGCTGTAGCCACGTACCGCCACTACATCTACGACATGGAAGCATTTGTACCGGTCCTTATCGTCACAATTG
TAGCGTACTGCTATGAGGTCACCTTCTTTGGCAATCCGCAAGAAACAGGATGCCGCGAACGCGCTAGTTGGATGAATGGACATAGCTTTCTCATTGAAAC
TACCAAGCGCTACTTCAATGGCAACATCATTCGGATGGCGCCTCTGGACCCTACGAAGCAGTACGTCTTGGGTTTCCACCCTCACGGCATAACACCCATT
TCGGTCATGTGGCTTCAGTTCAACGCACAATGGCGAAAACTCTTCCCGAACTTCTACGCACATATTTTGACGGCCAGTGTCATGCATAAACTTCCTCTTT
CGCGAGACCTTCTTCAATATTTAGGCTCGCGCGAAGTTTCCCGACAGGCTTTCACGTACACATTGCAACAGAAAGAAAGCGTCCTGGTTGTACCTGGTGG
GCAAGCCGAAATGCTGGAACAACAGTCAAGCAAAAACGAAGTCCGCGTATACACTCATCATAAGGGCTTCATTCGCTTGGCCATCCAGCACGGTGTGCCG
TTAGTTCCTGTCCTCAGCTTTAATGAGGGCGAGATGCTGGATAACGTCCAAGTTCCGATGTTACAGCGGTGGTCCGTGAAGAAGTTTGCGGTTCCGTTCC
CATTCC