Description :
From Genome Similarity Track
Location :
Scaffold_35:325474- 327942
Transcript NameFunction/comments
g2716.t1hypothetical protein

Sequence
2468 bases(100 bases per row)
CCTCATGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTT
ATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCCAGGATGCCTCGGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTTCGCCATCGCGG
CGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAGGGCTATGCTCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCA
GCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAAT
CAACTCCGGCACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCC
AAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATACATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGTATGAGAT
CATATCTCGAATCCAGGTCAAGGACCAGTCAGCGTTCAACGCTATCGAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCG
GGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAA
TTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAAAGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCCTGCATACACGTTCCG
TGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGACCCGCGCCTAC
TGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCAGGGCTTCGGCTCGCCGGAGCCTGGCGCTGCTTACGCAGCGGGCACCCTGGTC
GCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGCTGCTCGGCAGCATGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATC
CATCGGCTCGGGCCCACCCGAGGAGCCGGTGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTC
AACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCACGCCAGTGCGAAGGCCTTCCATGAAGATGGTCACCG
TGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGTTCGTAACTCTTGGACGAAGTCCACCAATTCCTTCTTTCCTTGGCGGGTAGCCAG
GAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGAC
GTGCCACATGTCAGGGCCCACTCCCGAGCCCGGCCACCGAGCTTGGACACGGCCAGCGCCACGCGCTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGG
CCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCCTCAAAGGTCTTCATGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATC
CGATGCCGGCTTGGGCGTCATAGACGCTGTCACAGCCGTCATCTTCTGTTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGC
GCATTAATCGCCTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTTCCGGGCCCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTCGGGGGTA
AGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTCAGGTGTAGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTG
CGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAACCTTGGTTCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACT
CCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTTCAAAACGTGAACTGATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGG
TAAATGTATAACACTCACTATCTACCATAGCGGAGCCTAGTAATATGCATGACGGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTACACACACCAAC
TTGGGTGTGCACACCATTTGTGTGAAACACACTATTCGTGTACGATACACTAACGGGTACGTGTAACC