Description :
From Genome Similarity Track
Location :
Scaffold_6:3254673- 3258529
Transcript NameFunction/comments
Phyin_T30-4PITG_04838Cytosol aminopeptidase%2C putative
Phyin_T30-4PITG_04839Putative uncharacterized protein

Sequence
3856 bases(100 bases per row)
CACTGCCCCACATTTCGTGCTTCAAGATGCTGCGTCGTTTCTTCTCTTCTTCGACTGCGCACCGCATGGTGCAGCAACGCGTGCAGGGGCAACTATCTTT
GTTAGCCATGGATTCCTCTTCTCCTTTAACGCGCGTGGTGTTTGTGTCTCGCTCGGCCACTGCTGACCTGCAGAGCTCGCTGCCATTCCCTGTGTCCGCC
GCCGCGCTACGGGACTTCAAGGCCAAGCCACAGGAGAAATTGTATCTGTACCCAAGCGAGGACAATGACGCATTTAAAGACCAACGCGTGTTGCTTGTGG
GTCTCGGAGACGCCAACAAGGTGACGCCCAACGTCCTGCGTGACGCCACACACGGCGCGTTGAGCGCACTCAAGGCCAAGCGCGCCAAGGACGTCGTGAT
GCAAGTGCCCAACCTCAAGGACTGTACATTGGACGCTGCGCGTGTCGTGGAGCTGCTGTCCCAGGCATCCATGCTGTCCAACTACCAGTTCGATCAGTAC
CTCACGGACTCCAAGGACGTCTACGGAGAGAACAAGCTACGACTACCTCTGGAGCAGATCTACCTGGATACGTCAGCTGAGTTCCAAAAGGTGATAAGTG
ACGGTCGAGTATTATAATATCTCAGAAGACTTACGGGTGGTGCTACGCTGTAGAACGTGGCGGAGCAGGTGGCTGTCGGCGAAGAAACCATCTTTGCACG
TAACCTTGGTAAGGTCATACGACGATGGAGTGTGGGTAGTTACTCGATACTGACTATGGTATGATTTGTTACGTAGGCAATGGACGCTCGCACATTGTGG
ACCCTGCGTTCATGGAGGAGGTGGCGCGTGCGTCGACTGAACTTCCCAATATGACGGTCCGCGTGCTGCAACAGGAAGATCTGGAGAAGGAAGGCATGAA
TATGTTCCTGAGTGTTGGTCAGGCAGGTGTGTGTCCTCCTCGTCTAGTTATACTAGAGTACAAGGGCAACCCGGACTCGGACGAGAAGGTTGCACTGGTT
GGCAAAGGTATCACGTTCGACACTGGCGGCTTGAACCTGAAGCCGACCGGCGCTATCGAAGACATGCACACGGACATGTGTGGCTCTGCTGCTGTACTTG
GAGCTGTCCGCGCTGCTTCTCGTCAGGGTCTCAAGGTGAACATCGTCTGCGCCCTAGCTCTGGCTGAGAACGCGATCGGATCCAAAGCTGTGAAGCCGCT
GACGATTGTCAAGTCGCACAAGGGCATCACAGTAGAGAACAACAATACGGATGCTGAAGGGCGTCTGGTGCTTGGTGACGCCATGTCGTACGTCCAGAAA
GAGTACAAACCCAAGAAGATCATCGATGTGGCAACGCTTACTGGTGCGTGTATGGTTGCGCTGGGTGAGCACTGCGCTGGACTATTCTCCAACTCGGATG
ATCTGGCCAAGAAGCTACAGGAGACCGGTACAGAGTGCCACGAACGCTGCTGGCGTCTACCGATTCTTCCTGAGCACACTGCCGCTCTCAAGGGTTCGCA
GTCGGATTCTCGTAGCACTGGTCGTGGACGCTATGGCGGTGCCTCCACCGCTGCAGCATTCTTGCAGCAGTTCGTCTACGAGGGCATTGACTGGGCACAC
CTCGACATTGCTGGACCGTCGAACTACAGCTCTCCCAAGTCGTATTTCCCTAAGGGTGCCACGGGTTTCGGTGTCCAGCTGCTCTACACGTACCTGAAGG
AGCACGAACAGCACTAGAGGTACTGTCCTTGTTAAAAAGGGTGTTAGCGTAGCATGTCATGCCCTCAAGGACTTATCTACGTCGTGTTTGTTACTCAATA
GAAATGGCAAATATGAAAAGCATGTTGAGGCTATGGAATCAGGTAATAGTCACTGCTCTGTGTACAGGTTCCAGACGAATACGCAGCCGTCGTCACCGAC
CGAGACAAGTTGCCGATCATCCGGACTAAAGGCCAGACCACGAACATTTCCTGAGTGCCCAACGCCGTCCATAATCAACTGGTTGGTGTTAAAATCCCAG
AGTTTCACCAGCCGATCGTTGCCGCCAGTAGCGAACACTTCGAGGTTGTGTGCTACAGCGATACACGTGGCTTCTTCGTTGTGGGCTTTCTGGATCACTG
TCACTGGTGTGTCGATGCGCAGATCCCAGTATGATATGCGTTTCTCCTGACCAGCACTCAACACTAGACGCTGGTCCGCCGACAGCGCTACGGTGTTGAT
CCCGCCCATACGCTGGATGTGGCTTGAAATTCTACGCTCATTACGCAGATCCCAGCAGAGCAAACTACGATCTCGACTGCAAGAAATCACGTGCAGGTCG
TCACGATACAAGGCCAGACTCGTGACAGCCATCGAATGCTCCTTGAGGTGTGAGACCAAGTCACGTTTGCGAATATCCCACACGCGCACCTCACCTCCGA
CTCCTGCAGACACGATGAACCGCTGATTGTGACTTAACACAAGTGCTGTGACCCCGCCAGTGTGCGCATTATCGATGGACCAGGCGAACTCACCCGAATC
ACTGCTATGAGACCGAATACAGCCGTCCGTCCAGCCTGAAATGAGCACGTCTAGCGAATAATGAAGGGATGAGGGAGCGCCAGCATCGCCGACGAAGCAG
CGGGTAGCAACGTTGTAGTCCGACGCATCCCAGATACGAATGGTGCAGTCTCGAGAGATGGTAGCGAAGCGGTCGGACACATCGGGAGCGTACGCTACCT
GCACGACAGCGTTCGAGTGGTTTTCGGACAGTAATCTGGCCTGCAGACTGCGTTGTGACGTGCCGAATGCAAGCCGAACAGTGAAAATACTACCAGCTTG
AGTACCAACGACAGCTTCGTTCTGTGCTGCGTTGAGGGTCAACCCGACGACGCCACTGTCAAGTGCGACGTGGCAAGTATCAATGAAGTGGTGATCATAA
TGAAGAACACTCCCGTCACCACCGCCCACGAGGATACCGCTGTCAGAGTACACAATGGAGTTCACACCGCAGGAACATGCTGGAATCACCTTAACTAGCT
GTCGAGTTTTCACTGTGACAACGCAAAAATCGCCGCTAGAACTGCCAGCCACCAGAACTTCGCGGTCAGGAGAGAACTGCACACACGTGTAATCACGAAC
GAGTGTCTGCTCGATTTTGTGTTGCGTGAGCTCTCCTGTGACTGGATTGAGGACCCAAAGCTGCAGTAATCGATGTCCGACAGTTGCAAACTGGTAGTTG
GCTGTATCTCGACGCTTTACGTCGCGTGCCATGCCTCCGAATGCCACTGCAGTGACGATATTTGAAATCTTTTGGTGCGTGGCGCAGATGTTACCAGTCA
AGACGTCCCAGACGTACAGCCGTGGTCCGTCCTCTGGTATCCCCACAGAGCACAGTAGTCGCTCGTCATCCGAGAATGCCAGGGCAGCGACACCTGCGTC
GTGCTCGGATAGTCGGAAAGCAAGTCTCCGAGCTGAGTAATCCCAAACGAGGATATCGGCTCGTCTGCCACGTTCGCCCGAAGCTAGAATTCTTCCTGAA
GGAGACATCGCGATGCACGATACATTGTCCCCATGGCCACGAAGGAAGAGTTGGCTATGCGCATCTTGGAAGGATGTCAACAATACTGATCCACCGGCAG
GATACACGTAGTCTCGACCCGACGGGTGGTAGTGGATAGCGTTCGGTACCGCTGAAAAGCCGATGGTGTGCTCCAACTCCATGGCGGTGGCAACCTGGGA
CTGCTTGTCGAAACGTTGAAGGGGTTCACTTATAATTGCAGCGAATCCCCTTGAGCTGGTCTTACTGTCGATGGCAGAAACACCTTCGTAACCATGTGCA
TTGTTACCGCGGTCATACTGCATTACGTCCGGCGTTTTACGAACGACTTCTTGATG