Description :
From Genome Similarity Track
Location :
Scaffold_177:32543- 35339
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_177-snap-gene-0.25Conserved gene of unknown function

Sequence
2796 bases(100 bases per row)
TTGTATCCAAGAGAATGGCACGAACTCATCTGAGAAGACTGGGGGTGACTCGAGTGCAATTGGAAACGAGGGCGATGATGGCGGGAGAGCAAGAGCGACG
ACTTGTGTTAACAACGGAGGAGTCGAGCGATTAGTTTTTACCATTACTGCCTGAGGTGCAGTGCGCAGACGTCTGTCACCAACGTTTCTGCGCTCGAAAG
CATTTGACCCAGTGTGAGGCCGTACTGCCATGCTGCAGTGTATATGCGACACTTGATGCACGAGACAAAGCAAGGTGGGTAGCTGCGCACTTGTGCTGGG
TCTACTCAGTTGTACGTTGGTGATTGCTGCGAACACGTGCAAATGTTGTTTGCAGCTTTTGAAGCGACAAGAGAGAGAGAGAGAGAGAGTGAAGGAATAA
GATGAGTTTGTTGCGAAGGTATCTGTTTATATTTAAATTACAGGACGATTTCGAGGAGCCAACTAGTTGTTGTTGACTTCCGCCTCGCAAACGATTCGGT
GGTGGATCGATACGCGAGCAGCACAATGCTAACTGCATGCAGGTACGCCTTCATTGCACTAAGCATCGTAGATGATACCATGTACCGTCAAGTAGCTACG
CTGGGTTACGTTTTCTTCATACCTGATTTTGAGTTTGAATCCAGGTGAATACTGTGGCCAGTAGGCCTCGGTCGCTGGACTCGCCTCCGCAGATCGGTGG
GTCATCGGTCGCTGGCACTTACGAAGACTTTGGCAGATTGGCAAATCCTGTTTGCTGTTTGATGAGTCACTCTGTGCACGCTGTTACGAAGCGCCTTCGA
GTAAACGATGTAGCCATCTTGCTTGCTTGACAAGACCTGAATCGATACATGTTGATTGGTTGCCGTGGATTCGCTGGTTGGTTCAAGAAGCAACAAATGA
CGCAACTGAGTGCGTGGATTGCCATTTACCCGCATGTGATGATCTCAGCCCAGGTCAATTCATCGGCAGCAACGATGCGGACGCATGAGAAGTGGGCCCA
AGAGAGATCGCTTCGTGCCAAAGTATGAACCATGGGCACAAGGTACACGCGTTTAGTCTCACTCGATCTGAAGTACCCGAGAAGAGTCTTCGATGAGTAC
CATCGCCATGACAGGTACACAATCGGATCCGAGAGCATCGTGATGTTCATGAGGTACATTGTGGCTTCGGCGAGCTCGGAGCGCTCGTCCAGCGTCGAGA
TATTCACAGGTCCTTCGAGTTGCTGCGATTGCAGTTGTGCTATACTCGGAGGTACACCGTAATTCGTCAATGCACGCTCGAGTCGATTGAACTTGAAGAG
GTCGTCTCGCCAGCTTACAGCCAGAGAACTTGTCGGCCAGAGGACGCCAGCGGAAAGCGGCACGAATGAGAACGAGCGCGCAAAAATGAATTGTACGTGG
ATACGCCGACAGACACATCTCAGCACTAATGAGAAGGTACAGGCGACGGCAAAGAGTGCTAGCGACGAGAAGCAAACGGATTTGAGGTCCAGAAATACAC
CGCCTAGGGCCGATTTCCCTGAGCCACCGTTCTCGTTCAGCATCTCTTCTATGGGTGGATGCAAACGCGAGATCATGTCGATACGCTGGACATACCGGAT
CGGCATCGACCGTAATGAGATATAGCGGAACTGCGACACAATTGTGATCGACGAGATCAATGCGATGGAGAACTGTGGTAGCCCCCAAATGCCGTGCAGT
GGCGACCAGCCACGTTGCNNNNNNNNNNCGTAATGCGTACGACTATATGCGCTGCCCCAGCGAGCACCCACACATTGCGCATTTGCACGGAGCTTACAGT
GATGAGTTCCATCAGCGTGAGCTTGAAGAGTCCATTGAACGACGAGAACTTTTGCGCTGTAAACTGGTACACGAGAGGCGCATCGATGATGTGCGCTATG
AGGTAGCACGCCAACGGGAACGTGCTCCCGTAGATGATGACTTGGCTTGGGACCTTGAGGCACATCATTGTCGCTTGTCGAATCCGCGTAAGGAACCCAG
GCCGTTCCGTTTTGTCCCGCCGTGCCACAACGGCGAAATAGCAACCCAGATATAATGTGATCACTCGAAGCCAATAGTACGCCTGCGCGGCACCGCGCAG
CAACATGACAATCGTGTGCCACCCAAGGATATCTGTCGTGAAACTCTCGCCTTCGTACCGATACTCATCGACGATCATGGTCTCACACAACGTGGATGAC
GGCGAGCAGTTGCGGACTCGAAAGAGCGTGACGATGTCATTTGCGGCTTCGCCGACAAATANNNNNNNNNNNNNNNNNNNNNNGGTGGATATCGAGACCT
TTGCTGCCTTCGATGATCGTCAAATCGATCGTTGCATTCGGGTACTCGTCGATAAGTTTTCCAAGTCGCGTCGTGAGGTGCGTTGAAACGCGTCCGACGG
CGACACAATTTGATTTCCAAGGGCGGCATGAATGATCGAATCGAGCCCAAAGAGTTGGGCAAAAGTACGGACGCACGCCGCCATACTCCNNNNNNNNNNN
NNNNNNNNATGGAACAGACATCCACGACCGTCGCGTTGATCGAGTTTTGTTGTAGCTCTCGAGGTCTTGACGACGCTAGGTTTGCAGCTGCAGCGGCANN
NNNNNNNNNGGACTGTAGTATAAAGCCCGACACGTGCGCCACAAGGGCGACTGAAACACCTTTGGCGCGACGTAGTGGTGGACACGGTCATAGTACTCGT
AGTTGGCGTCCAAGTGCATAGTTTGCGGCCGGAGATGGATGCTTGGTACTGTTTCTGCTGTTGTGGCTGGCACAGTTGCATTTTGGAACNNNNNNN