Description :
From Genome Similarity Track
Location :
scaffold_29:3253- 8962
Sequence
5709 bases(100 bases per row)
aagcgtctacgacggctagatagtcttgccgaaacggcacctcaaactcctacGAGCTCTCAGTGTTTGGGTATacccaccacttcacaagtaatttttt
ttacccGGTCAACGACGTCGGCCcacatggcgctccacgtgataatggacgccaccattctcgtcaaaaagagtcggtggcaggCGATGACAACATAgcc
gatcgccgtccggtggctCGCgacgctcttcgagcgttgaagGACAAAAAATGCCGTCATCGGACTTCTGCCGAGCATatctccgaggtcgcctaccgct
gtgcggaagatctCGAACACCTGGATCATGCATCGACTGCTTTGCGCTGATGAttgtcgtgctctgtcggagcggctcgtATCCGTCGAGCATGCGAATT
TGTCTttttgtgcgacggtggaatgccttgcgccgttggaaacggaagttgttgcactccgtgatcagaaccagttgctggctcaACTTTTTGTTGGCCG
ACCGCCTTTGGGTGGCGCCCCGGCGCTAACGccttcgcgttcacttgcgccggatcccggtacggcttaagctaacccacataaaacaccgggtgagtGC
GTATCTTTCTCGGAAGATTCAGCTTATGTGCTAGggctcgcttggccacgaccttacaaggtccaataaaccgtggacggagctttgttttAGACAGCGA
AATGTGCATGagtaggaaggttttgagCGTTTAATTAAACCAGTTCTCTGACCTCAGAGTTTTGCACATTtctttgcttcttccatcagCATACTCTTTT
TGCttatcttggctttcagctatcgcatcgcaaaaGCGTCATCGGGGCACTCAGTCTCGAAGGCAGGAAGTCGTCGACATCTTTACAcacggtgaggggg
ctgacatcagctagttgTCTGGCTTTTCCTCCCCACTAAGCCCTGATCCATGGAATGGCGGTGTAAGCGAGACGCGCGGATTAACAAATTTGATCACATA
GAACGGCATGTAGCCGGtggatgaatgcactgcattgttcagagcaagctctacgagtgataacatagcgctccagcgctttagCGTCTCAAAACAGACG
CTGCgatgaacgtcttcaacggcGATTCAGGCGCTCAGTGTGACCATCGATCGGTGAATATTCCGCtgatgacatagtcaacttgatgcACAGctccctg
aagattgtcgaccaaactttCTCAGTGAAGAGCGGGTTTCTATCGAAggaattgactccgggagtccatgctgtcgaaagacatgGTCtataaacagcgt
cgctgtacccacaccgtcggtggtgtccggcactgccgcaaaatTAGCCATCTTGCACAaatggtccacaaagaccactacacccgtgttgcccgccgag
accttcggcagaccaaacTCAAAATCTAAAATCAtggccaacacccggagggttcCGGCAAAccggccagcggcgccgccgcattcggagagagttTCTC
CCTTCGACACGTCTCGCACgcgcgcacataggtgctcatccatttgtacagcttgggtcaccagtagtggcaacttacAGGGCTGTAGGTCTTCACACGA
CCAAGCTGACCACTAACTGGGGTgccgtgggcctcatagaatAAACGGTATTttatcctcatcgtgaggaaccacaaatcGTGACGTATCCGTTGATTCG
GTGCTATGATAAGCAATCCATcattcaatgaatatcggtgcaaccatGCACGAAGTCGCTagaacttcttgtccgagtttctaagccccttgctcccgag
agcccgtggCAGCattacgcacatatcatcactcgCGTACGCGGCGCGGCTAAAATACGTCACTGActacgtcaccgtcgtgacatgagcatgcTAATAA
TTTGGTCGATGTGACAACgcttcagccaaagcattctgattatctggcttatacttcacctcgaagatatATTCGACAAAGAAGCTGAGCCACctgacca
tcctctgcgagaggtttGGTTACTGAGTTGCGGTGCACAGTGACGcacgatctgtgtagatcataaACAGCTTATAGcggagcaggtgcaccctgaactt
gacaagtgcatacttcatcgcaagcagttgcttgtcgtggactggataATTCCTTTCTGCTGCCTTGAGCGGGCGAGATTGGaacacgatcacccgatct
cgcccctcggcgtctgcttgcagcagtgcacagccgatggtaaagtccgaagcatcgcagacgacactagaaggacgatcggggtctgacaacgccagta
ttgctgCATGAAGGAgtttttttttctaaaaCTGTCAAAGGCCTCCCGaagctcggtgtcccaacaccattccgcaacCTAATTAAGGATgttcgacaat
ggctgtgtcatttccgcataatttgcgctatacttgtgcaagaagcTGGCGAGGGCGAACTACTTGCGCTAGTCCTTTTATTTCCTTGGAACTGGTCAGT
ACACAATGGCCTTAATCTTAGCGGGAtcagctcgaaggccacgcttgccgataaagcaccctaaagaaGGGAGTTTTTCGGCGCCAAAgatacacttgtc
tgcattagcatacaacatatttgtgcgcatgcactcgattaCCActtttaaatggacgatgtgatactcttcatccgtcctcccgtgccccgcacgattg
tggacgaagatgttatCGAAGTATATCTGCGTATATGCCCGAAAGGgcctaaacaattgcgtcacaaaccGATtttatgttgctggtgcatagACAGCTC
TTGGGGCatcgccagccactcccagagcatcccgctcggagtattATATCCCTGTCAGCGGATCAcatgctctcatgagcaattggtaacaacCATTGAC
CAAgccgagtgcgctgtactttgtacagcgagccatattgttctggagaacatcgtTTCTaagaatcggcgtttgtgtcggaatggtggcagcgtttatt
TTATTGTGTGCGTGTAGGATACGCCActaccgttcggcttccggacacaaaaggtgggagacttgctctcacgtaccattcctgccaAAGGCGTCAAAGA
GGTCGGacagctccttgggcaggggccattggcgagTTACACAGGATTTGGTTCCCGAGCTAGGTCAATCTCACGACGCACAAagctcggtccggaggta
gaatCGTACAGctggtctttggagacgacgtcttgacatTCATTTACCAAAGAATTAATGGGATCCGAAGAATTCTTCAGGATTGATGACCCACTCTGTG
CGTTTAGCACCTttttagtgtcctccaggacatcttcatccagaagcgatgacaaaTTAATCTCCTCATTCGGTATAACAATGATCACCTCGGCTGATTT
GATTGCCTACAAGGCATTGCTAAGCTCTTCGGagggcatctcgtccagtTCAAGCCGAACATCCACCGCGAGAACaacctcgagggtgacgtcaccgtct
tcctctcccgacATACTGATAACGacggtatatagctgtgcgctatcgtcaacGCTAGACACACCTttagtcagggtcgacggaTTGCGTCTTGTAGATA
CGACTTCGTAGTCCTATCTCTGTAGAGGGAGTAtgtctcgtcgagaccaATGGGAAAACACACTTcgcatcgtccagtgtcctcactccctgctccatcc
gAAAcatgatgttatctacaacatccgacgaagggtTtcaatttccgcagtcttcgtccagtggataatgtgccactccacccGTATCattggggcctcg
cccttaatgcctcggacctcgtccgactatgccattcttggcatgcagcaaatgctttgtaacgtgaacagtgctcagtggatttcgtgccaatccacgt
gtatcacaagggcctttcccttgatgcctcgggcccttggccgaccatgccccTCTTGAAACACAGCGACTgttccgatacttgagcagtgctcagtagg
TTACGTATCatttcacgttcagcccgcgagcccgGCTCTAGACTCTTGTCGAAAACACatttggtgttcgacaactcggatactctgatatccagcacat
tgaccgtcctggtccagtgcccgcaccaatagcgcttctactTCCTAGCAGCGGTGGGTTCATGGCTCACCAGAGCTCCACTAGGAGATGTGCGCGTGGC
GACCAATGTCCTCACCTCCAAtaaatccatggctcatggtgcccCAACCATGACATACCAAGAATTAGGTCATATCTTGCATTCAATTCCAAGACTGGAC
AGCGATCCGCGCAATCAAAGTCATGGaagttgacaccgaggtccacagggaccctctgCGCAGTGGCACAAATTCCCCTCGCtatgcgaacagtgacggc
gtCACTCAGCCGCGCATCCAGCTCCTCCACATACAGCTGAttttcttcgatcgtggagcgtcgcgcatatttgcccgacgccccggaatcgataaatATT
TTCCATGGCATCATAAACCTTTCAAGGCTGCTTTTGCGACCAGCAAGCTtagcttgcacacacgttctgtgttcaggagcacgaagctcttcggtctggg
ccctgctgtcctctacctctttgaggcgcAACAGAACACAGTTCACCCCCCGTAGGTTGCCCCGCGCCTTTTGGATTTGTTCGTTTCCTCGCGTCAAACT
AGACAGGTTAGAAGGGGGACGTCGgctcgacgaacctttacgcgccgtGTGCAGGGGAAAacccgtccgaaggtgacaggtgtctccacagacaaaacac
ctaAGCAGCTCGGAACTTATCCTCTTCtttctcctctttctcagcatagctgacatCAATTGACcaaggcccgctcgacgagatcGGAGTgcgtgcattc
caaccaagtcgtgtcgatTTAAAGTTgcattcggcattcaataccacgttcactgcttctttaaaaaaagacgaatgcagacggaagacttccattctgg
ccacgccagtgcggtgaAAAACGCAGCTTGAACCGAAGCGCCGCACGTTAGTACCCAGTCTCGTGCTCGGtccccgagcttgaagatagctagcaccacg
agctattgctcgttttggagcatagcagatgccatagccatctcggtctcTCACAGCCAGAGCAGGAGAATTTCTCCTTCCTCATTCTTGAAGGTCCTAA
CGATTAACATGAGCGCCTGGGTCgaaaaaatcatccgtcgttgacggtgacgtcatagacgcagtcgaaACTGAGAGCTTCTGTTGTATGTGCTCTaaaa
gagcatttttataactTGAAACAACTcaaggcgcgcgcttatggcctcgggTCCTTGCGCAGCGAGTTGCTACACGTCCTCAcggcccagcagggacatc
agcttattaagcccgtcctgcatacccCGGGGCGAACAAGAacattcctccatcctcacaaaggatcagtcgtaacgacgcaggcgtaaattgactacga
gtgctaccaagtgcagcgaggctcgtagctttttgctgagAGAATGCTAAgcaaagtcaccgaccttacgttctttccaagtcTCagtcgagtgtagcgg
attgcgatccgctacctccacgTACTAAAAATCTAaatcaaggcaaacgaacattcCTGTTTAAAAGTGAAACtgaatttaattgtttaattgcggtaga
gccgccaaC