Description :
From Genome Similarity Track
Location :
Scaffold_66:32525- 35231
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-snap-gene-0.42Double stranded RNA binding
Pytap_DAOMBR444maker-pag1_scaffold_66-snap-gene-0.28SURF1

Sequence
2706 bases(100 bases per row)
CTGCTTACGGGGCCAGGgCCGTCATCGCTCTGCATATGTGATGCCATCAATTGGATGTCGGCTGTAAATGCGGATAGGTCGCGACCAGTTCGTTTTACCG
AGGTCTGCaCTGTATCTGAAACGAGTGGCaTCGAGTAGAAACGCGTCAATGCGATCAACGATATCCTCACGGATCTTGATGGTGCTAAAGCTTGGTGGCA
TCTTCACTCGATAACGCATGAGACGGTTGATCGCGTTACTGAAGGGCAGAGAAACACTTGgGTTAGAATGACGAATGAtcAGCGAACTGATACAAAGGAC
GAACCGATAGCATTTCCACGGCTGGGGCTCGATGATGATATGCTCCGCAAGCTCCGTGAGGGACTCAAGAACCTTCCACAAACCATCGTCGCCATGGTTG
AGGTGGATCCACATCGTCACACTGAAGAGGGTGACGAGATCGAACGGGCGTCGAtGTTGAGTATCAGCGTCCAGCTCATGCACAGGGAAGCGAGATCTCC
CGACACGCTCGAGAAAAaCATCGACAGCAGAAGCGAAGTCGTTGTCGACCACGTTTCCATGAGCGAAGAGCACTGCATCGTCGTGAAGCGAGGCAGGGtc
GACTGCTCGAGTGTTCGCTCGATCAATGAGATCTTTATCAACATCGACGCCTAGAATACACAAGCATCGCCTGCAGCTTGTCTCTTGGATCGCCATGTCA
AGGGATGATGCATCGTCCTGCTCATGACTCTTTTCCGGTTCAACTCCCtggTGGGTGGCCGTCATCTTTGCCAGGGCAGCGCTCGCaGCCTTGGCCTTGG
CGACCTTCTTCGACACGCCCTCGCTTCGCGCCAGGGACTCTCCGTCGACGCGCAGGTCACACACGAAATGCCTGCGGTGCTCCGATCCGCCTTCTTCcGT
GAACACATACTCGATGCGCTGCTTGTGCTTCTGTACGAGCTCGTTTAATGTGCTCACACTCGCCTCaTCAAACGaCACAACATCCACAGCACTAGAACTA
CAGCTACCATCCGTCTGTCCAATGAGATGCTTGAAAAGCCCGATTGTCAGGTCGCCTGGATGCACCACATCCGCATCAGCGTCCaCCAAAACGCCTCGTC
CTCCCACCATCCTCTCTGACCTTCGTTACAACCAATGTCCATGATTGTCGCTGGCTGATCGTCGCTCGCTGtCTTCAGgAGCAGCGCCCGTCGCAGCGCC
GCGCTCGTCGGCGCGTCCATGAagCGCAGCCGCTCATGTGCCGGGTTGAAGCTATAGTACGCGTGGAAGTTGCCTAGCACGTGGCCATCCGCCCATGGCG
TTGCCTCCATTTtGGCTGGCTTCTCTTCCTTAATGTTGGGTGACTTTtCCGTTGCATCGgTTCGTAACTGATACGATCGACACGCCGCGGCCCATTGACA
CACTCGGATCGACGGCCTCGTTCATCATGCTGCGGACCGGCGCAAGACGACTGCTGCAGCGCGCGCGTGCGACCACTAGCGCTTCTACGCGTTGGCAGTC
CACTGGCTCCGAGGCGGTGGCAGCAGCGGCACCAGAGAGCAACTTCTCGCGGTATGCGGGCATCGCGTTCTTCTCGGTCATTGTAGGTGgTTGGCTCCAT
GGAGGACGCTCGATGTAGACTGGCGTCGTAaCGCGTTGCAACTGAACTGCAGGTGGCTGGTACAGCTGGGCTCGGTGTTTGGCAGGTGTGGTGGCAGTGA
TGATAGGTGGTGATAGTGTGTGGTCGTGGATTGATAAGGGACAtGCCAATAGACCCAACGCTACTACTGGAAAGTCGGCGTGATCGATGAACGCAAGAAG
CAGCTACGCCACAACCTTGTGGACCTGCCTGACTATGCTACGGCCTTgAGTGAGCTGTGCGTTCCATACGGATTCTTTCtaTGCGTTTTTGGAGACTGAC
cGAGGAGCTGCAGTGACATTCCCGAGTTCTGCCAGATCCGAGTCACCGGCCATTACAAGCCAGGCAGCACGTTCTACCTGTGTAGGTCGAGGCTCTTTGT
GAACACGGATATTGCAGCCATTTACGGACGAAATGGATGCGCACAGACCCGCGTTCGGCACCAGCTGAGTCGACTGACAGCGTCGCCACGCCCAAGTCGG
GTGGCTACATCTATTCCTTGCTCGAGCGAGACAACGGGTGAGTGCCGAGTCTATTGGAAGCGCACTTGATGGATATGACTGATCACATGCTTGCTGTTCG
GCCAGTTCGCCTGtGATTGTGAACAGAGGGTGGCTGCCACGCAAGCTACTGGATGCGCATATCGCCCAGGAGAAGAAAGAAGAAGATGGCGAAGTGACAA
TCGTCGGTGTGCTTCGCCACGGCGAGACGGTGCGTTGTGCTCTTCGATTTGGTGGAACCCTTCTCGCGTACTGAAGATGATCTCTGGTGAATGTGGTCGA
GTAGAAGGGCCaGTTCACGCCTGACAACGATGTCCCCCGTCGTCAGTTCTTCTACCTCAACCATGACGAGTTGGCGGACGCCATGGACGTCGAAGAAAGC
ATTCTGCCGGTGCTGCTCGACGCAACAGGTgTCATAGTCATgTGACTACTTGTATTGTTCGGTGTCTGACGTTCTGATCCTTTGCCAGCGGAAGAAGATG
ATACCGAACCAGCGTCTTTGACACACTTCCAACGCAAAAAGCTGAGCAGCTACCTTGAGTTCTACATGACTCCAGAGAAACATGCCGGCTATGCAGCCAC
GTGGTA