Description :
From Genome Similarity Track
Location :
Scaffold_64:325248- 333037
Transcript NameFunction/comments
Phyin_T30-4PITG_17921P-type ATPase (P-ATPase) Superfamily

Sequence
7789 bases(100 bases per row)
CATTCAAGCATACTCGATGACGAAGATGTTGAAGATTCAAACAGGAACTGGAGTAATCTTGGCCCAGCTCGTCCTCCGACTCCACCTCGGCCAAATCCTT
CGCCGATGATGACTTCCCCAATCATCGTTGCCCGCCCGCCTCCTTCGCCACCAGCAAGTCCTCCGGCACCAGCATCTTCTCTTCCTGTTCCAGTGTCTCC
TCGTCCGTCTATTTGGACTCTCGATGCTGGACCTGGACGCATGATTACGGCAACCTATACTTCGGTGCCGCGTCGTGGTGGTGCACCGTCGGTTGAGCCG
TTGCCTCACCGAGTGTTATCTGGTACTCGCCCTTCGGTGCCGGCTTCGTCCACCCTGCCACCGTGGGTTCTTCCGTATGTGGACATGGAGTTTACCGATG
CAGGCGCCAAGAAGTGTTTCGAGCGACTCTTGAGCTTAACGCTTCCTGAACCAGCTGGTGAGGTGACCGTGCGTACAACGTTGGAGGGTCTCCAAGCGTT
CTTTGATTATTCGCATCCTGATCACCCGTACCAGCAGCTTCGGCAGCTTTATCCTCTTCAAGCTTGCCTCTTTGACACTGTCGACTTCAAACCAAGCGTC
CCCATCTCCAAGCGTGCTCCGATTGAGACCCGTCTCAAGATGATCTGGGCGAACCTTCGGGGTGACGGCGGTAAGCAAGGTGACCTCGGGTTCGCGTTGT
GGGAGCGTCTCCACTGGCTTCCGTTAGCTGGTATTGAACGAGGTCTCGCTGAAGAAGCTAAAAAGGTTGGCCACGACAAGGAACGCTTGAAGGAACTGAG
AGCTATGTTAAAGAAGCTCTTCAGTGAGCGCGACCGTCGTGCCGATCGTCTTCGTAACAAGTACCGTGAGCAGTACATGGCGTGGAGTCGCGACTCAGTT
TCATCTAGTGCTTCCGGCGTGTCATTCATTCGTCCCGAGTTGCTTTTGGAGCCGTCTAAGCCGTGGTACCCCATTGAAAACTTGTCATTCGCACCTCAGA
CATCTGACTGGCTTTCCGAAGTTCCGGCTCTCGACGCTCGTCAGCCATGGCGTACTGGATGGATGAATGCGCCGCATCAGCACCCGTACAACACCACGTA
CTTCCCGTGCCAGTGTAATCCGGAGTTCTTCAATCCTCGTGGTACGCGTTTCGTGGATGTGTACCGAAGCGTGAGCGTTGACCCGTCTCTCGATTCAACC
GAGCTTATTCCGACCTGGCGTTCGTTGTTTGACTCGCCACCGGGTACTCCACGTCCTGCTCTGGCTGCTGCTCCTGTTGAAGCTGGTACCGAGGATTCGC
AGGGTCCGGCTTCAGCTCCAGCTGCCGAGGCTCAGGTTCTTGATGAAGAGGAGAAGGAGAGTGGTGACTCGGCTTCGTTGACACTCTTGGCCACCGCGGC
CAGACACTTGGAATCGATTTGAATCCTCGCTGCACGTTCTACGACGTTCTCCAGCATCTCAGCTAACTGTTGAGGCGTCCCGCGTGACTTCGTTTTCAGT
GATCGCTCCGCGGTCGGCATTCATGTTTTCTTATTCTTAATCCACTTCCATAGCGTAATCATGTTCATGTTGTTCTTCAAATGCATATACAATTTGTTGT
TGCAGTAACGTTCTTCGTCTGTTACCACAGGCTGCATCGCCCTGTGGACAGTTCATACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGCCATC
TGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTTGATGATGGTTCCCAAGTTGTATCTATATAGCCAA
CCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTG
GTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTACCAACCGAGTGTTCGGTCGACTGTTG
AATTCGTTGACAGCCTTAAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCCAGCTCGTACGCAAACTCTTCCACCT
TGCGCTTGATCCGAAAAGGTCCATGCCATTGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTC
AAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCA
GATTTTATCAGTCGACTCAGGGCCTCCTTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAGGGCGACCTCATGTT
GTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCA
ACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGT
AGAGGGTCTTCCCGCGTACACCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTG
ATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTAATGATGGGGCTCCGAATCGTCGGTA
CACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATTTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAAC
GCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCAGGTGAGTATCCAC
GAAACTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACAGGACTTCACGTGCTTCTCCACGTCTGCGTACAAGCCGATCCAATAATAATCGGACTTAAC
GCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTTTGCAGGACCTCTTGAATCATCGTTGTTGGGACCACAAGCCGC
AGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAAATAGTGAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCATACTTCC
AGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGCGTTTTCACGAGTATAATGTGTTGGA
GTGTTACATGACCAACGCGATCGGCGGAGTGCCGAACAGTATCAGCTTAGTGCATTGAATGCACTCTCCGCCGGAGATTCTCCGGCGGCAACTGCGCAAC
TGCCCTCGAGCTGATCTACCAGGTACTGACTGACTTGGATACCGGTACATGTACATATATTTTTACTACAGTCGTGCACCTCCAATTCGGCACCGGTATC
AGTCGATACCCTGCCAGATTTTATGATTACGCGAATCGGATGCGCAATTACCTTTGCCCATCACCACCCTAACAATTAACCTCAACGATTCCCCTCCTCG
CCGAGGGATGACACGCCGCATGGGCAATCTGATTTTAAATTTTGGATCGGACGTCTTCATACAAACACACACTTTGATTTTTACCGCCAAAGACAATGGG
ACATCGCCCTTCCTCCTACATGTCCCACAAAAGCAGTCTTTGTGCAAGAAGCACAAGTCAGATCCTGCATGCTCTCACTCCGAACTTGCTCGTTGGGCAA
CGGAGCGCTTTAAGACCCCCCGAGCAGTTAGGCGCATTACCGTCCAGAGTATTCTTAAGCGGTCCGCGGAAGTTGCCGCCTTGCCGGACTCCAATCCCGA
CCGAAAGCGCTGTTGCGCGCCCGCGATTCGCGCGTCTGACGCCAAGATTACATGTATGCAAAGGATTGGCGTAAATTTTGTACTGAATTAACAAATAAAA
TATCAGTGCACTGGATTTGCGTTTGCTTTTTGCTTTACGTTGTGCACTTATGCTCTGGCACTGTTGATATGGTCCGCCCTGCCGAATTGGAGGTGCACGA
CTGTACTTCGTATTCATACATTATTCCTACTACTTCGAAGTACTACATGTCATGAAGCCTCATTACTTTGCGGCAAGGGCTTTACGCGTTTTTGCGAAGG
GCAAGTTTGCTTGCAGCACATCTGTCATTGCTTCGTCGACTTGCGCCACCCTCGTCCCGTGTACGTCCAGTACACCTTGAAGTGGCCTCGCACGGTTGCA
CCAAGCAGCTCGAAAAACGGCAGGCAGCTTGCTGGCGTTTACGATCGCTATAATGCACAAGGCAACACGTACACGTCGTTGCTGGAAGATCACCGACGGT
GCTTGCGGAGGCTCGGAAATCTACAATCGGCAACTTTTTTCTTTGTGATCCTAGCTAGAGACCGCCCGCCTCATCTGGCAATTTCATGCTTTCATGTTCG
TCTCTGTGTTTTGCCAATCCGTTTAACGCTCTGATAAAGATCCGGTGGATGCACTGGATTGCCATGGCTGGAATCGTAAGTGTACTTTACAGTCTGAAAG
TGGGGTGTGCATGTATTAAGCTTTTACGCGTACGTTTAAAACAAATGTACTGTACATCTGCGAAGGCTATATATGTACCGGTGCATGCATAAAATATTTT
TTAATGCTATTAATACAGTGCACGTAAAATACTATGGCGAAAGCAAAAGCGATATGCACTTGCTTTTTTAAAAGCGGTGTTTTGTTTGCCGGTATTTAAA
AATATTAGAACAGTTATCGTACACGTATTATATTAGTTACCAAATTTTAATACCTGTTTATTAATAGGCAACCTTGTTCAGCCAACAGAACAAGAACAAA
ATGCAACAGCAGTCCAACACATAATAGCACATTATGATAAACTTAGCAGTATTTCGGTAGTCTTTGCGATCCTGTAGCAATCATGTACTGTGCAGTACTA
CGGTTTGGTGGTCTCGGCTCAGTGGCAGCACGACAACTGCTGCCGCAATACAGCAGTGCCCGTGCGCCGCTTGCCGGTCTAGCAACTTGCTCGTATTAGT
ACAGATAGTACAGACTCGCTCGTATTACTGTAGTACTGTAGGCTGGTTGCCTCAACCATGCGCTGGCGTCTCGTAAAACGAGCCTCAACGTCGACGTCGA
CCTCCTCGTTTTGAATTTGCACATCGCTTCGGATAAAGAAGATACGGAGGCTGTCGTATATGGTGTGGCTCACATGACAATCCATAAAACCTCGCCCATC
CTTCACTTGTCGAAATAGGCAGAATGCATCGTTTTGTATTGAACAGACGAGCCAGCGTGAGGTAACGAGTCGGTTCGAGTAAAAAAACCTCGGGTTGCCA
ATTCCTTTGGATCCGCTCGCTGATTGGCCAAATAGAAACAAATCAGCCAATCACCGAGCGGTTATCGAGAAGAGAGCAGGGGCTCCCTCCAAGGCGGACA
GCAGCACCTGCGGTTGGCGTCGTGTGGACGGGCGGTACTCAAAGTCCGTGGCGGCAATTTCATTCTGCAATTTCCCGACAGTCAACGACGCCAGCGCACT
TGTTTCTTCGAGTTCGCAGTCGTCCGTTTCCCGTGGAGACCAGTCAGAGCGTCTTCGATCAACTAACCGTCCCAGTCTTTCTGTCGACGAAGCCTCAGGC
TCCGCACCAGACACACCCCAAATGGCTGGTGCCGCAGGTAACTCGTACATGTCCCTGGCGACGCCCAACGACGTCAAGAACTACACGAACGACGTCGGCC
AGATCCAGTGGGCGCAAGTGCCACTGAACGCCGCGCTTGACAAGCTCAAGTCGTCCCGTGAGGGTCTGACGTCCGATGAGGCCGAGAAGCGTCTGGCCGA
GTACGGCCCCAACAAGCTGCCGGAGGAGAAGATCAACAAGCTGACGCTGTTCCTGGGCTTCATGTGGAACCCGCTGTCGTGGGCCATGGAGGTGGCCGCC
GTGTTGTCGATTGTGCTGCTGGATTACGCCGATTTCGCTCTGATCCTGTTCCTGCTGCTGCTGAACGCATGCATCGGCTACTTGGAGGAGGTGCAGGCCG
GCGACGCTGTGTCGGCTCTGATGGGCCAGCTGGCGCCCGAGGCGAAGGTGTTCCGTGACGGTGAAATTAAGAATATCCCGGCGGACCTACTGGTCCCCGG
TGACGTGCTGCGTGTGCGTCTGGGTGACGTGATCCCGGCCGACCTCAAGTTCCTAGAGGGTGACGCGGTCAAGGTGGACCAGTCGTCGCTGACGGGTGAG
TCGCTGCCGGTGACGAAGAACGAGGGCGACGAGGGCTACTCTGGTTCGGTTGTGAAGCAGGGTGAGATCGAGGCCGTGGTTACCAGCACGGGTGTAAACA
CGTTCCTTGGCCGAGCCGCCGAGAAGATCGCGTCCGCCGACTCGCACGGCCGCCTGCAGATGGTGCTTATGACTGTGGGAAACTTCTGCATGGTGTCGAT
CCTGTTCTGGTGCGTGGTGGAGCTGCTGGTGCAGATGGCCGGCCGTACGTCGCAGAACCCGTGCGTGATCGTGACGGACGGTTGCCTGGGCGTGGCTAAC
ATTCTGGTGCTGATTGTGGGTGGTATCCCTGTGGCCATGCCGACGGTGCTGTCGGTGACGCTGGCCATCGGTTCGTCGGCTCTTGCCAAGGAGAACGCCA
TTGTGACGCGCCTGACGTGCATTGAGGAGATGGCTTCGATGGAGGTGCTGTGCTCGGACAAGACGGGTACGCTTACGCTGAACCAGTTGTCTGTGGACAT
GGACAACCTGATCCCTTACAACAACTTCACTGCGGGTGACATCCTGAAGTACGGCGCGCTGTCGGCCCGTACGGAGAACAACGAGGCCATTGACGTTGTG
TGCCACAACTCGTACCCGGGCAAGGACACGATGTGGCAAGAGTACACTCTTCTGCACTACACGCCGTTCGACCCCACGACGAAGCGCACGATTGCCAAGC
TGAAGGACAACAAGACAGGCGAGATCCTCCGTGCCGTCAAGGGTGCCCCGCAGGTGGTGCTCGACATGGACGTGAACGCTGACACTCTGCGCGTGGAAGT
TGAGGACCGCATCGACGAGTTCGCTTCCCGCGGCTACCGTGGCCTTGGTGTGGGTATCTCTCGCAGCGGTGACGTGCCGGTGGAGGAGTGCGAGTGGCAG
ATGATTGGTCTGCTGCCGTTGTTCGACCCCCCTCGCCACGATACGGCCGACACGGTGAAGAAGGCTATTGCTCTGGGTATTGCTGTGAAGATGGTGACGG
GCGACCAAAAGGCTATTGCCGTGGAGACGTGCCGTCAGCTGGGAATGCCGACCAACATCCTTGACACTTCTTTCTTCAACACTGCGCCGCCTCCTGGACT
GAACCTGGCTCAAATGATCTACGACACGGATGGCTTTGCTCAGGTGTTCCCGGAGCACAAGTTCGAGATTGTCAAACACCTGCAGTCTTTGGACAAGGTG
GTTGGTATGACCGGTGACGGCGTGAACGACGCTCCGGCCCTGGCTCAGGCCGACATTGGTATTGCTGTGGATGATGCGACGGACGCCGC