Description :
From Genome Similarity Track
Location :
Scaffold_198:3252- 6502
Sequence
3250 bases(100 bases per row)
GCTTGTGCAGCCGCAAATGCCACCAGAGGCTCACTATCGTTTTTTTTCCTCGCAGTGCTCAAGTCATCTCATGGCCCGGACCTTATGGTTCTCTTCATGT
TTGTATATGTGTCTATGTGCGATATGCAGCCGCCTCTGCTCCTTATGCGTGGTGTGCTAGCTTGCGTTGATGTTAACATTGCCGTTCCGAATGGAGATAA
GCTTTGTGTTTAGCGCTGCACTTAAATTCATGTTTGGATCGTAACGAGGTGAACTTTGCTGTTCCATTTGGAGGTTAAGCTTAGTGTTCAATACTACTAC
CACTGTATACTAACTAGCTATTGAGACTAAACACGTAATACACCCTGTATTAGCTCCCTATCCCTAATCGTTCCTCATGCCTCGGTGTTATTCAGCGTGT
TGTCCTCCACAGCCTCGTCTTCAATGAAGGTCTTGTGAACAAGTAGGCGGCGCACCTTTTCAAAGGCAGCGACTACGGTGCGGTTTAGATGTTTGCGCGG
CTCCCACGTTGGCTCCCACTCCACCAGGTTGTACGTTCTGCGGTTTTCGCGCTTCCAGTTCAGCAGTTTGCGAACGTGGTGCTGCTTCTCGCCGTCAAGC
TTCTCTTCCGCGTTTTGATCGGCCCACTATCGGGCAGATCATCGTCAGCAGAGGGGGGTACAAGCCACGCTCGAACGTCGTCGAGACCGAAACGCCGCTT
CTTTTGCTTGGCCAAGGATGAGATGACGACGTCGATGGCTTCAGGAAGTAGCGTCGGCGAGGCGATGGTCGTATTCATGATAATGCGTAGATGACGGATG
GCTTCATCACTAACCCGAATCTTGTTAAGCTTGGATGCAGAAACACACAGCCTCTTGAGCTCTCTGGTCGAGCTGATAGCGTTCTTGACAGGCTTGATGG
ATGGCATGATACGGGTGGAGGCAGGAAGGAAAATGAGCGACCGGATTAAAGGATTAAGCCGCCAAATGCAATCAATGGACGGAGTGACGCTTAAACTCAG
CTGTACGTAATTACGTGGTCGAAACCACATCTAATATGTTTGTTGTGTGAGGTGGAGCAGGGTCTTGTATGCAGCCTCCAGCTTGAAGGCGCCTATAGCG
GTTTATGCGATAGTTGAGGTGGCCGCTCTTGTGGAGTTTGCGCATTGTCTTCAGCACGTTTTGGGCCCCGCTCGCGAAGGTATGCTAACAGAGCTTCCTC
TGCTCTGGTTTCTTGCCTCATAACCTCGTCTCTGTATTGTGGTAACTTCTCATTCAGTACAAAGTCGTCCGGAAGAAATAGTTTCATGAAGGCGACAATC
TGCTTGTTGGTTGAGCGCATATGCTTGCTTGAAGCGTCCGTCGAGCACCACAGACGAGGTTCTTGTGCGTACCAAGTAAACCACGCATCTTTCAGTCTGA
CAGAACCAGAGGTACGGCGTCGCTTGACTGGTGGTGTGTTTGTTTCCGCATCTTGACTAATCTCGATTGACGCTCTTTTCTTTTCTTGCTTGTTGTAAAC
CTTAGCCTCCATTACCGACAGACGCACGTCGAGCTTCTGATTTACTTGAATTAACTGCTCAATCAATGATGCTTGGTGAAGATACATGGGGTGTTTGGTG
AAATCGGTTGACGTTTCTTGAACAGCAGCGCTTTGCTTTACGTCAGATAATCGTGGATCTCGAGCCAGGTACGATGACCACGAGAGTAAGTCATTGCATG
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATGCTAATGACTTGCAATTAGTAGGGGGATATTAATATCTTTGGTGGTCCCTCCGACTTGATACGTCGGAGGCGTGGTTCTCTTGCCATCACGTA
CTCTCGCCGTCAATAATTGACCTAAAATCGGACTGATACATGATTTAATTCATCTAAACGACATTTTAACTCGTATCTCTACTTCTATTGGATAATATTA
TTAATAGTAAAAACAAGTATGGTCGGAGATCTAATGAACATCCATACCAT