Description :
From Genome Similarity Track
Location :
Scaffold_3:325174- 328123
Sequence
2949 bases(100 bases per row)
TCGATTGCGTGACAGGTCACGTGGATGGTGAAGTCGGCCTTACGGTCCTTTCATCGTTAACTGCTCCGTTAGAGCTGGACGAAATGTATGTACATGAGTC
CAGTCAGGCCTTGAAGGCAGGTGACTTATCCGATATGGTGGTCCTTAGACCCGATAATGAGTTGAACTCCTCGTCTATAATGGATGAAACGGTCCTTGAA
AAGACAAAGGCGGCACGTAGTGCACGAAGTGGATCTTCTTTTTTCAAGAACCCTTCCGATACCTACTATACTTTGGTCAAGGAATTTCAAGACGTGGTAT
GTCATAATCCACCGCCTGTATTAACTCCCGATGGGGGCGTACGTCATGAAACTGACTTGGTTCCTGGGACCAAATACTACGTTAAAAGGCAGTGGCCTTT
ACCAAAGGAACAATTTGACGTCAATGACGGGTTTTTAAGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCTGATTCCACGCCAATATTT
TGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCAAGCTTATAATAAGCTTAATGCGGCCACTATACCGGCACAAAAACCCATTCCTGGAAAGGACG
TTCTTCAGAACAACATGGCAGGATGTACAATAAACAGTGCACTCGACCTGGTTGATGGTTATTATCAACTGCTCATGCGAGCAAGTGATATCTCGCTTAC
GGCGGTTAGTACTCCAAGCGGTATGCTTTGGGAGTGGCTGGTTATACCCCGAAGACTTTCCAATTCCCCGGCTACGTTTAATTGTCTGGTAACGCAATTG
TTCCGCCTTCACCGTGCGTATGAACAAACATATTTCGATGACATATTTGTCCATAGTCGAGCGGAACAGGGTCGCTCGGACGTGGATAACCACATCGACC
ATTTACGAGCTGTGCTCGAGTGAATGCGCACTAGTAAGATCTATGGTAATGCATCAAAATGTATCTTTCGTGCAGATAAGATCCCATTTTTGGGGTGCTT
CACTGGGAAGCAAGACCATCGGGCAGATTCTGCAAAGGTGGAAGCAATAGCGAATTGGCCAGTTGCTAAGAGCCAAAAGGACCTACGCAAATACTTGGCC
TTGCCAATTAATTGCACAAGTATAGCAAGAATTACGCTGATATGGCTCGGCCATTATCCAATCTCCTTAAAAAGAATTTAAAGTGGTGCTGGACTAGCAC
CGAAGCAGAGGCTTTTAAGGCCGTAAAGGAGAGTCTCCTATATGCCCCGATTTTGGTTTTGCCAAATTCTGATCGGCCTTTCATATTGTCTGTGACACTT
TGGATTTTTCCACTTGCTGTGCTCTGGTTACAAAAAGATGTTGAGGGACGCGATCGTGTCATCTCATTGAATCACGCCATATTAAAGCTGCCAAAAAGAA
CTATCGAGCTCATGACAAAATTCTACTTTCTATGAAGTATGCTCTAGTCAAATTCAGAATTCATTTTCTTGGCTTTAAGCCTTTTGTAGTCTATACCGAT
CATGCGTAAATACTCACGGCTACCCAATCGCCTCATCTCTCGCAGAAAATGGCCCGTTGGATTTCATTTTTTGCAGAATATATCTTCGAGGTGAAGTATA
AGCCGAGGAGGCAAAATACGTTGTCTGATGCGCTGTCACGACGGCCTGACTATGAGCTTGCTCATGTTACGATTTTGTCGTCGTCAATTACTGACAGAAT
CGGTGCATCTTATGCCAATGATGAACAACCTGTGGCTTCGCTACTATATCTTGGAAGCGATGAGTTTAAGGGGTCGGATATTAAATTGTCGGCACGTTCG
CGTGCGGGGCTACATCGATATTCTATCGATAACGGCTTGTTGTGCTATCGCACGGATGATGCGGGTACCCCGCGTATCATTGTTCCTCATGATGATGAAC
TGAAGTATCGAATCGTCTATGAGGTCCTCAACACAGCTACTAGCGGTCATTTCGGTCGTGCGAAGACCTATGGGTTAGCTAGCTATAGTTATTGGTGGCC
CAAACTCTATAAATGGGTAAGAACATACGTGCGCACATGTGAGACGTGCCACCGGGTCAAACCCCAGCTCATGCGGCTGTGCTGCTGGCTAGTTTGCCTG
TTCCCTCTGGATGTTGTGAATCCATCAGCATGGACTTTGTGGTTGGCCTACTAAAGGATTCAGTCGGCAACACAAGTATTGTGATCTTTATCGATCGTTT
GAGCGAGGTGGATCACTTAGCGGCTGTGCCGGACTCCATTAATGGTGGAATTATAGCTTTGCTGCTCATTGGTCTCGTGTTTCTACAACACGGTATGCTA
CTAGCAATTGCCTCTGATGGAGACCTTTCGATCCACAGGTAAATTTTGGTAGCCCATCTTTAAGGTGCTCGGCATGCGATTTGACAGATATACAGAGGAT
CATTCACATACCGTTGGTCAGACTGAGCGCTTTCATCACGTTCTCGAAGATGTCCTACGCAGCATGTGCGCTGATACGCCTCGGCGTTGGAGCTCAACGC
TCCCCGTCGTTGAGTTTGCCATGAACAATGCCGTCCATGCCTCAACAGGATATATTTGTTCTAAGTGTACAGCATCGCCCCCCCGCGTTCCGTTAACGAT
ACCACTACGTTGTTCAGGGCTTGGGAGAAGAAGTGGTCGATCGGCTTGCTAATGTCAGCTCTGATACTATTCAAAAACAGGCCAGAGCGTTCTTTATAAC
GCGTTTGAATGTTGTACAGCACCTGCGTGACGCAATGGCTGATAGCCAAGAAAAACAGGAAGAACAAGCGTATGCTAAAGACATAATCTGTATTGAAAGT
TATGAGGTCGGTCAATAAGTCTTACTAAATGCTAAGAATCTACCTACAAATGAAGTGTCTGCTGTGTTTAAGACGAAGTTGCTTCCTCGCTTCATAGGAC
TGTTTACGGTCGTGGACAAGAAGGTTCTTGTGTATACGCTCAGCTTACC