Description :
From Genome Similarity Track
Location :
Scaffold_18:325100- 326219
Transcript NameFunction/comments
Phyca_LT1534110668serine protease family S01A, putative

Sequence
1119 bases(100 bases per row)
gttaacgaggagaaccgcatttatggcggctctgaagccaatatcgacaattacccgtacatcgccagcctccgctttgaagagcaggacgaaaccttct
gcggcggcacgctgatcgctccgcagtacattctgacggctggtcactgcatcaggacagaagatgacactatcatcgcccacttaggcacggagtttgg
tacgggatctggatcgggcgaggcgattaaggtgacggagggattccggcaccctctgtacaaccaggcgaagcacctttacgatgtcggtctgctcaaa
cttgagaaggaatcgacgcagaaggctgcgacagtgtgtgccgcagacggctcggacaatccggtcggcaccaaggcgacagtgttgggatggggattga
ccgaagacggatcgaggagcaacacgttgcaggaagtgaacgtagctgtcatttccaacgcggaatgtaacaagcagtacaacaaccgcatcacggaagg
catgatgtgcgctggcaatggtgggggtaaagactcgtgcaatggtgactctggtggccccttggtcactagcgatgacacgctcattggcttcgtgagt
tggggaggaaaatgtggcgtccacgccggtgtgtacactcggctgacgttcgtcatggattacatcaacgacattctgaatggcggctctggcagcaact
tcacggacagcacggcgtcttctgggtctacaacgcagcagacttcactcgcttcatcaacggcgggatcagctggtacgccgagtgtagccaactccag
ctcgggggcatcaaccgcgcagacttctactgccggttcgtcaactacacaatcctccactgctggttcaagctcaggttctccgactacaacatctgca
tcatcagcaacagacagttctagctcttctgctactacgacggacactcctgctgtgacccctgcggctaccacagactcgactgattcttcctctacca
atgaatcacccgtatcgtcgggctccagttctattacggagagctctagcgactcatctgtgacgcagactgcaacgacagacgctcctgcagtgacccc
tgcggctaccatcggctcg