Description :
From Genome Similarity Track
Location :
Scaffold_179:3251- 6340
Transcript NameFunction/comments
Phyag_g3137hypothetical protein
Phyag_g3138hypothetical protein

Sequence
3089 bases(100 bases per row)
GTGTTTTGagcaggaagacgaggacgaagaatATCTGGTGTAAGTCGGTGCCAAATGTCGGGAACGAAATGAATGCCCTTTGCCAGCTACATGTAGTTTT
GTCAAGAGAAAGTGTGTGTTTCtacaagtacatgtagtgaaCTCTCACGCAATGTCTGtgcgtcgtctccatacGACAAACTAATTTTCTCTCCAGATCA
AACATGCAGGTGACACTCATCTTCAACTTAAGACACAAAACCATGCAACATCCAATGTCTCCGTTGACTCCGCTGGCATCTCAACAGTTTGGAGCTCAAC
CTCATGGACCCCTCgtcgctactgctgccaCCTGTAGGCACCCGCCATGGCCAACACTTGCCTCAAACCCCAAAAGCTCGATTGCAGCGCGCTTGTCGCT
CGGTGGCCGATTCAACAGGTACCGGATTCGTGTATGGCACCATGTTCGGGTCGGTTCTTGCTGTGGCGGAAGGAATGCGAGCGTCTCCAAGACAGCAGAA
ACTGCGAGGTGTACTGCATCACGCCAAGGTGATGGTGCCAGAAACGGCAGGTCGCATTGCAATGGTCACGTGTTTGTTTCGAGTGGCGGCGTTCGGGATA
GAAGAGCTTCGAGACAAACGAGATATGTGGAATacgctgctggctgctcctgctgcaggggCTCTGATAAAAGTCCGACATGGACCGAGAGCAGCATTGA
ACAGCGCGTTTGTGTTTGGAAGTTTTGCAGCGGTTGTGGTGGCGTTCAATTGGGCAGAGGCCAAAGTGACGCACGAGAGCAGTTCTCCGGGAGAGGTGCT
CGAAGAGATCGCGTTTGCTGAAGAGTTTGAGTGGGGCGACTGAGGAGAAAAGAAGCTGTAATATATCATGCTTGCTTTAACACATTGCTGCGCTTAAACG
TTCATAAGACACGGAGCAGAGTACGTTAAATTTGGAGCTGGCCACCGATGCCTTAGTGCTCTTATCTGCTAGATCCACCACTTTCATCCCTGCATTCACC
AATTTGCAAGCAAGCCACAAACTCGACCCACCCAGGCAACAATGTCCGAGGCAGAAAATGACTCATGGACGTGCCCTACTTGCACCCTGAAGAACGAGCT
CATCGTCGAAGCGTGCGCCGCCTGTGGTGCTACCAGCCCGTTGGTTCTCCAGAGCTACGCGATTGAGGAGCAAGCCCAGGAAGGAGGACGCTCTCAAAGC
TCCAGTTTTGTCTCCCAAGGATCGGATAATGCTACACCccgtggtggtgacgacgacgaaatgGATCCATGGGCGCAGGCGGAGTGTGAATGGGCCAACG
TAGAGTCTCGTCAAGATGCTCGTTCGAGGAAGTAGAGGTATCGGACAGGAGCAGGCATCACTTTAGATAAAGCACCAACAATTTCTACTTAACTGCAAAC
ATGACTCCTGTTTCATCGATATCAGACCCAGCAGCTTTACCCATATTGCGATGGGTTCGTGTGCCAGTGGTGTCCGGTGCGGTGCCGGTGCGGGTGTAGT
TTTGGAAACGATGATACACCGACAAGTATGGCTCGAAGAGTTGCGAACATGTGCGATCATCTACCAGGATCTTGCTTTATTCGACTTGTTACCCCCAGAA
TACAAAGACAACTGAAGCGTACCACACCGCACCCCGCGTATCCGAGTGGGGCTGTTGTGTATCCCGACCACCTAACTCAGCATCAGCGCTTGTGTGGAAA
ATGTGGACTTGGACGATCACGGACTACGTCCGAGCTGGTGATAGTGAAAATGTTATCAAACGATTGGAAGCTGGTGATGATATCAACGAACGTCGATCAG
GTAACTACACCCCGCTGGTCAACGCTGTCTACTACAACAAGTGTGAAATGATCGAGCTCTTGCTTGATAAGGATGCTGACATTGAGGCAGTCGACAGAAG
TGAGTTATCTGCTCTTCGCACAGTCATCTACTACAAAAACGAAGAAGTGGCCATCCTGCTGGCTGATGGAGGTACTGACCCAAACATACTTGGGTATCAG
CAGCTATCGGCTCTACATGCTGCGGTCCAACAAAGCCAAATACCTGTTGTAAAAGCTCTCTTACTCGCCGGTGCAGACTCAACAATTGTAAGTGGAAGTG
GCAAAATTGCCATGGAACATGTTCACGGAAGTTGTGCTCAAGAGCTTATAAATTTGCTCACAAGTTTCACAAGTCTTGAGTTGGCTCttgcaacaagaag
cagcgatGGAGTCGGGGTGCTGTTGAAAAAAGCACTGTCTGAAGGCGCTTCCATTGACAACGCATTGCACGCGTACAAGACAACAATGagtgcgactgct
gcaacggaGGGAGCCTGGAAAGATGAGTTATCAGAAGTTGTCGAGCAATTTGAAGGCTATATGCTTAACTATGCGCTGCGCAGTGGTTCGACTGAATATG
TGGATAGCGTCAATATGGCTATTGGGAAGCCCGAGTGGGTCTCAACTGCACGACTCGATCCAGACGGCCGGAATGCActtcatgctgctgctttgcgtGG
AGACGTAGCAATTGTTGCCTACTTGTTGGAAAGCCACAAGTGCGACTCAACTGCTTCCGACGACCACGGGTGCAAAGCTGTCGATCTTGCCAAAGAAAAT
AATGAACGTAAGCACATCACGTGGATTCTCACGGAACATGAAAAGAAGACGAAATTCTTAGATCTACCGTCACAAATGTTAGGCCAGAACGAAGTGACGT
TGGTGGAGCTACGCGAGTTACCACAGCTCATGACCAGCATTTACGACTTGCGAATCTTGTTCTTCATAGCTGATGGAGCACTGACAAAAAGAGAAATGAA
ACAACTCCTTCAGAACGCGTTCGCAGAAGCTGTTCGATTGAAGCTCATGTTCGATAATGACGCTGCTGTGTTTTTTTAAGACAGTTCTACGAGAACGCAA
GCGCCGCGATTTAATCTCGCTaaaggagaaggatgagTGGGAAATTGAAGCCAGACACGTGAACGCTGAGAATGCCGACTGGGTTCGTGAGATTCAAAAT
TCGCTTGCGCGATTGGAGAACcgagttgcagtcgctgagAAGAATATCTTATCGCTAAACGAAAACTGCACCATGTTgcgggacgcgct