Description :
From Genome Similarity Track
Location :
Scaffold_36:325091- 330368
Transcript NameFunction/comments
Phyin_T30-4PITG_14581Putative uncharacterized protein
Phyin_T30-4PITG_14582Putative uncharacterized protein

Sequence
5277 bases(100 bases per row)
TCGTGAGTGGAGCCATGTCTGCTTCGCTGAAGATGCGGCATCTGACACAGGCTTGCACCGCAAAGCGTTGCGTAGCTATCGATCAGAAGGCGTCATGCTT
GGACAATTAGCCTGCTTGCGATTCACGTGTACAGTACCGTCCCATCATTTGTTTTCTTTTTTCTACATGTAATACATTCGATAAACATTTTTTTATTGCT
TTACCACTGCATGCGGCTCTTTATGAAACCGTCTCAGCTCCCTCCTTCTTCTGATACCCCTGTATTCTAATCGTCTTGTCTCGTACACGAAAAAATGAGC
TAATCGAACAAAACCGCATTCATCACTGACCAGAGGCCACCGCCAACTTGTCTCGGTCTCTTGGTCATTCTACAACGTGCCGACTGCCACTCACAACTGT
CGACTAAACCACTTTATAGTGTAGTGACATGGTCTCCACTGCTTCCGAGTCCGCCACCAACGCGGGCTGGCACGACCCGACCGATGTCCAAGTGCGCAAG
ATCATGATGGCAAGACTACGCATTCACCCGGCACTATCGCAACACCATCCGATCCTACAGACACGCGAGGACACTGGCACGAGTCCGTCACTGCTGCAAC
GTCTCGAGTGGATGCTGTACCATTCTGCAGGCTCTTTGAGCGAGTATCTGCACCAGCCGTCGCTCGAGCGACGTGTGCAGGGCCTCGTGACCCACTACAA
GCGCAAACGATCTGAGACAGAGCCCAGTGAGGCCGTCATGGCGGCAATGCGAGCCTCCGCTGCCAAGCGACAGCGACCTCGACTGACTATCACCGAAGAA
GAGATTCGCAACTGCAGCGTCGGGGCAAGAGGCTGCGTTCTTAATAGCAATTTGGACTTGTTGCATCAGGTTTGTAGCTTTCTGGACGGCAAGGCCGTGC
TACGATGCCGCGGCGTCAACAAGTTCCTGTACCTCAATGCACCGTCCTTCGTGAGGTCTCTGCATATCGATGCCGGGTCAGCTCCTGTAGCAGAGATTCG
AAACCGCGGCGATGGTGCAGCCAGTGGACTGAGCACTTTACTTCACGAATGCAAGAACCTCAACAGCCTTACGATCTCAAACCAGGCAAACCGGGTCCAT
CTGAAGGCGGGTGTTGTGTTCCCACGCGCGTTGACTGCGTCTACCTACATGGCATCGCTCGCCACAGCGTCGTACGGCCATCAGTTGGTTCGTGAAGTGG
CCAATGCACTGGAAGCAGGCGCGTGTCCTTCGTTAAGGAGATTGGAGCTCCTGGCTCCGTTCGACTTTGCAACTGAGAGTGACGCGGTTTTCAGGGTGCT
AAATGCGCTGACAGAGTCCAGCAACGCTAGAAATTCGCTACGGCACTTGGTGCTTGACGCAACTTTCCTCGGTGACCACGGGATCCAGCAACTTGCCGAG
CTGTTTGAGAGGCGTAACACGTTCTTCGAGCATCTACAGACTCTGACTGTACGCAACAACTTCATGGGCGAAATAGGGTGCCGCGCGCTTCTCGAAGCCA
TCGAGCCGTTCAGCGAACTCCAAATGTTGGACTTAAGCCGCAACATTCTCACCGACTCGGACGCATTTGCACTCGCGGATTTGCTTGACGATCCCGTGGC
AGAAGAAAACTTGTGCGACCGAATGCATGCGGATCGGAAGGTCTCGTCTGAAGATGAGGAGCTGTTTAATGTGCTGGGACTGGCAGGAGTGCGGACTCTG
AAGCTGCAGGAGAACTTTATCACTTGTGACGGGTTTCACGCCATCACAATTGCATTGTGTTCTCGCGAACGCGTTGTGGCGACAGTCGGGGATGCCACAA
GTTACTTTGTTGAGGAGAGAGACGACGAAGAAGTGATAGTGCAAGAGCGCTAGATATTTATGAGCTAAACATTATAATACGCGAAGATATATAAATATAG
TGCACTATAATTCACAAATTTGGGCTTCGCTCTTCTCTTTATTGTTGCCATGCGTCGTTGAGCGCGTACGAGTCGAGTTTTCCATCGAGATATTGGCGAG
AGATGGCTGCGTCCAGTCAAGGCGGTGATGACGATGAGGAACGACGCGCACTTGAACTCGAGTTGGCAGCTGAGCTGGCTGCGTTATCCGCTCAGGATGT
CGAACTCGAAGGAAGTTTAGACGGTGATGTTGACCAGAACGACGGCATTGGCGGCTGCGGTAGTAACGAGGTGATGTATGTGCGCTTGGATCTGGACAGT
GTGTTGAAGCAGGTGACAGAAACGGGAGCTCAAGGTTTGCATAGTGTCGACAAAGAGCACCAAGTTTCACCGTCATCTTGGGGGCTTTTGCTGCAAAGTG
TTGCACGTAGTGATCGCGAGTTCTTCCAACCATGTCGAGAAATATTACACGAAATCCGGACGTCTATTCTAGACGTAGAGTCTCCAATCTCAAGTGATGA
ACCACAGACACAGCGACCAAACGAAGAGATCAAAGGCCGCACGGCCACATCGGACGAGAAGACAGACAGCCCGAGTCTTGGATCCACTATCTTTTATCTC
GAGGAAGCTGCTGTTAAGGAGAATGGAAATCCCACAAGTTTGATCGACACGGTCACAAAGGAGAGTGCAAAGACATCTACAATGACCCGTGATCCCGGGG
GCTGCCACCCAACTCCACCACTGACAGCGTCTGATGGCCCTAACCAAGTCGTAGCTTTACCTGATGTCCCACCATTAACTATTGCTGAGGACAACCAATC
TGCGCTTACAGCTGAGCAGAAACAACTCGAGGCCATTGCAAAGCAGCACGAAGCTCGAGAGTCGCGGCGTTTGAAGGCGCAAGCTCGACACGAGAAGGAA
CGTGCAGAAACAGCTCAACTTTTAAGTCGACTTGAAGAGGAATATGAGACCCAAGAGAGAATCGCTGCTCGCTCTCGTCAGGAAGCCCAAGAACGATCAT
TTATGGCGAAGGAAGAAGTTTTCTGTCGACAATTTGCTGCTGCCGAGCGTGAAAACCACGAAATTGTGTTGATGACTCTCGCTGACGAAGAATCGCACAT
AGTCGCAGCTGAATCGGCTGCTTTACAGACCGCTATCAACATGGAGACACGTCGAATGGAAGCAGAGGATCGAGCTGAACGACATCGAATGCGAATCGAA
CGGCATCAGAGGCAGAAATCGATGACACGATGCCATTTTGCTGCTGTATTGCTAAATTTGGTTAAATATCACGAAACTCAGCGACAAATTCAAGCTCGAC
AAACAAAACGTGAACGTCGTGAAAATGTGCAAATGCGAGCTGAAGAAGCCTCCACGAGGCGAATAATTGCAGAGAGAGATCTGCTACGTGAGCAGCAGGA
GCGTGGGATGAATCATGTTTCAATGAATCTAGAAGATATTCTGGCAAAAGCTGTAGAAGACCAAGAACGAAGTCGAAAACTGGAGAATGAGGAGCGATTA
CGAGAACAAGAATATGGTGAGAGTATGCAGCAAGAAGAGAAGCGTTCTCGGTCTGCATGGGCATTTCGAGAGCTCTTGAAACTGATAGACACGCAAAACG
AGGAATATTCGCGTGATGCCATGAGGCGAGAGGAAGCTCGATGTCGACGTGCGTGGAATTATTGGATTCAAGTAGCGGAAGCAGAAGCAAAGGAGCGTGA
ACGAGACCGGATGGTTATTAATCTATCGACAGGATTCCAGCGTCTTGATCAAATACTCACGACGTATCAGTTGATGAAATTCCTTACAAGGTGGAAAATG
TGGTGCAAGCAGAGCATTGAGGAGGATCGATTACGATCTGAGACGGTCTCTAACGCTGCGAAACGGATTCATATTTGGCATCGATCTTGTCGGCAAAGAC
TGCAACAAGTCGTCTCTGTAGAGCTTCCACTAGTCCTCGAAGATTTCAGTGATGAGGAGCAGCCTCAAGCGGAAGAAAACGGTGACAACAACGCAGCTGG
AGCGGAGGTGTTGATGACAGCGGAGAATCAGGCGGCAGCTCGACGCTTGCAGTCAACGTTTAGAGGTTTCCATGTGCGAAGGAAGTTTGCGAACGCTTTA
GCGTTAGCCCAAGTGGTGGAGGAAGGAGATCCTTTTGATGGTGTAGATTTAGAAGATCTAATTCAACTGCCACCCGAACTGGTAGAAGGTTGGGAAGATC
CCGTGCTTCCACGCACACCTGTTCTGTCCCATCAACGGTATCCGCCGATATCAACGCGAATTGATCGTGTAGATCACGTGGAAAACAATGAAATAGTGGG
TCAGGAGAATGACAAAAATTTGGAACGTGTCAAACCTGAAAGTCTTCCAAACCCTACAAAGGAGCAGAGCTTAGCGGCGACACTTTGGAACAAGATGAAG
CGCCGGAAGCAGCGTCAGAAACACTCGCAGCAAGAGCGCCAACGCCAGCTAGACCCTGTGTGCCGGGTTCAGAAGCTCCTTAACCGCAAGCCCAATAATC
GCAATAACTCGAATCAAAGTGGAAACTCAAGCAACAGTCGGAGCAGATCGCAGTCCTCACAAGGTGGTCAACAAGCCACCAATATGATATCGTGGTCTTC
GACAACTAATGCGAGGAAGAAACCAAAAGTGAAGCTGCCGTCGTTGGTAGAGCGTCTGCGAAGGCAAACTATGGCAGAGCGATGAATTCTGGAAATCTAG
TGCGTTTCAATTATTTAGCTTGGATCAAATCCTAAAGCCAGTACCAGCTTTTAGCGCTTCGCCAGCAGCGAGGCCTCTTTTGTTTGGCGCATACAAACAC
GTCGAAATCTGCAGTGGCCACGAGGATCTCCGAACAGAGCACAGTGCCCGACTGACGATTATTCTCGTAAGCTCGACGCACCATGTCGTAAAATTCGTGC
ACGGTTGCCCCCTGTGATTGGATGTACGCTGCCAAAACGCTACCAGTAAGCTGCCCATTGCAAATTGCTATTAAACCAGAGAACTTACCTTCTAGTTTCT
CTTCAAAAAGAGCGAGAAACTCGTTGTAGATATCAGTGTATCTGCGAGAATTACCATAGTTTAGTTTTGATGCGATTTAAAACTGGAAACGCAGTTCCTA
ATACTCACTCGAGCTTCATCTCGTCACTGTCTAGATCGAATGCATGGCAATGATGCTCTGCAAAGGTCTCGAACGTGTGTGCGAACTCGTCGTTGTCAAA
GAAGAAGGAGATGACTTTATTCACGAGATCATTGTCGTCTGCGGCGCAGCTGCTTCCATCGTCATCTTTAGCGCCCGCTTTCTCGTGTCCTGAATGAGCT
TTGCATTCGCTAGAGGTAGCGGCATGAGGCTTCTCTCCAGCCTTTTCGTCCTTGGGTTCTTTGCTCTCACTCGGCAT