Description :
From Genome Similarity Track
Location :
scaffold_1347:3250- 4455
Transcript NameFunction/comments
g11316.t1 hypothetical protein PHYSODRAFT_321118

Sequence
1205 bases(100 bases per row)
TGTGCATGTACATGTACTCCACTCGTTCATGCCAATGCTTGTCTGAATGCGAACCCGTTCGTGGTTGCCCTTCCAAGTCATGCTTCGGCGGTCCATCGAC
GGTGGGGGGACATGCGCACCGAAATTACACGGAATGAGATCGTTGCAGACGTACGTTAGCTTCAAGTCTTTGAAGAGGCAGTAGTGATGCTTAAACAACC
AACGATAAATATACCCTTGCTATTGATCTGTTTATTTTCAAATTGGATCTTGTAGCGTTTCAGAAATAGAACGACCAAAACCGAAAGAGCCATGCGCATG
GAAGGCCGTCGTCACGGGGTCGTACCGGGTAATGCGGCCGGCGAGGCCACCGCCGAGCTCAAGCGCGAGGCCATCTCGACCTGCAGCGACTTGACAGACC
AGCAGCAACACGAGGACAAACTTCAAGCGGCATTTGCAGTCGCGAGCGTGATGGCGCGGCACAAAATGCCACACGAGACTTTCATGGAGTATAAGAAGGC
GCTGCGCCGCACTGGAGAGAACTACATCATCCCGGAGGCCTATTACGTGGCGGCCTTCATCAATGGCGTGGGCTGTCAGCAGCTTTCGCACTTGCTTAAA
GAGTCCAAGCCCCAAGATCTGGATACCGCCGCCAAAGAGGCCATTCTGCTCCAGCGCAGCGACGGAACTGGCCCATCTCTGCTGGGGGGCAAACGCCCAT
GTGCTAGATCTCCTCCTGCGACTCGACACAGCCACGAGATGCCTCAGAAACGCTCGCGTCGGGACTCAGGAGTCTGCTACGTGTGTCACCAGTTCGGCCA
CTTCGCGCGGGAATGTCCTGAGCGCTGGACCGATCACTAAGAGACCGCGGGAGATTGACATTGTTATATCTGTATGAGAACAGGACTACAAGCTGCGCGT
GGAAGTTACGGCATACATGATCTATTGCTATTCCAGCACCAGCTTATATCGACCAATCAGAACCCTCAGAACGACTAACTTCAACTTGAATCGATCTTAC
TGTATATCTACTACTACTACACTATTCAAAAGATTGAGACCCCTTCGAACACAACACACTGGAGAGAATGCTACTTCCAAAAATCTGGTCGTTCATGACC
TCTTGGATCTGCGTCAGGTACTCGAAGTTCGTCTTACAGTCCAGCGAGCAGAATCTTCCGGCGGTGCTGCTCAACGATGACATCGACTTCAAGAAGAGCC
GCTCG