Description :
From Genome Similarity Track
Location :
Scaffold_245:3250- 4269
Sequence
1019 bases(100 bases per row)
TATGTTTGATCATCCAATCTCGTACGATATCCATCGTTTGCGCTGGAGGGGAGTTCACCACTGCTTCTAGTAATTGAATCATGACCTCATCAGGTAACAC
GTCATCTTCCAAAGATTCATTCAGCTGCTTGCGAACGGCATTCGGAATTCAGGAATTAGCGACGTGTGCAAGTCGTAAGCGCGCATTAACATGCCAGGAA
AATCTCTAAGATAAAGAAAAAACTCGTCCAGATCGAAACATGTTCTCCCTTTAATCAGCAGCGTCAACACATCAGCATTGGTATACGCGGCAACCTCAGC
GGAGTATCTGGCGGCATAATCTAGCTACTGCTTAAGCCCTTCGAGGATAGGAAGCTATTCCTCCTGGCCAGAACGGTCAGTCCAATAATCATTCTGCGCC
GCGAGAGGCATCATATGGTATGCATCATCAGGGTGCACTCGTGTTAACAGCCATAAATTGTTCATCGGCCCCAACATAGAAGGATGTGCCACCGCTAGCT
CCCTTTGTAAGTCGTCGTCGCCTTTTTTCATACCATTGACGCTTCGTACCGAACAGAGAAGCGCAGGCAGCTCTTCCCAACTTGTTTTACTCTCCAGAGT
CTTGACAGCATCATCTTCGTTATAGGTGTGATCATTCTGGTACATGTCAATATACTTCAGCCACCGAATAATTACCTCTCGCAGATAAGCTTGTCATTAG
GCTCTTGCTAGTTCAAGTGATCGAAACGTCTGCTGGGTGTATATATTGCGAAATCCATTGAAGCGTGCGCACTGCAAAAAATGTGTCGGACAGAAAAGAA
AAGGGTTTAAAAATCACTCCTTATCGTTTCGCTGGACGTCGTCAGTCTTGTTTACGGAAGCGATGTAACGGGGTTACACATCGAAGGGTACGCGGTACCC
TGTGTCTTAGACGCACGGGATGGTATCCCACTGAAAGAGATATACAATATCTTAATCGGCTTATAGGGCTGCCAGCCACGAGATAGGAAAGATCTCGAAA
GTTCTTGGTTTAGGACATG