Description :
From Genome Similarity Track
Location :
Scaffold_2623:325- 2860
Sequence
2535 bases(100 bases per row)
ACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAAATCACAAAGGGCCTAGAGCCCAGAAG
GTGAACACGGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTCGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGATCAGCCGGGACTGGAA
CGAGATGACTCGTTCCTGTCCAGCCGTGTCGGCCCGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCG
TCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAA
GGAGGCTCAGCAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCG
GGGCGTCGGCCATGCTGCTATGGTCTTGACCTGGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCGCTTGTGACGCG
AAAACGCACTTGTCGATGTAGGCGTAGAGATTGTTTGCTCGCATTACGTCCAACACTCAACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTC
CCTCGGCACGGCTATGGACGAATATGTCGTCAAAGGACGTCGGTACGAAGGTGCACAAAGGGCGGAACAGCTGCGTCACCAGGCGATTGAACGTCGCCGG
GGCATTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGATGAGCTCACCGCGGTGAGCGAGATGTCACTCTCTCGCATCAGGATC
TGGTAGTATCCGTCTACCAAATCCCAGCGCACTGTACAGTACGCTCTCGGCCATGTTGTTTAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGC
ACCATCGCGCTGTTCAGCTTGTTATAAGCATGAACTAGACGTCACTTTCCGTTCGGCTTCCGAACACAGAAAGTCGGCGTCGAGTGCGGATATTTCGACT
CCCGCACCATGCCTGCCTTCCCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGCTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGT
GTCAGGCACGAGATCAATCTCATGCCGTACTCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGTTCACCACGTCCGCATACTCCGTCACCAAAGGA
TACACCGGATCCTTGGGGTTCTTAAGAATCTGAGAACCCAAGCGGGCCTGACGCAGCTTGTTTAGGGCCTTCCAGGACGCTTTCGTCCAGGACAGAGGAG
GAGTTCAGCTTCTCCTGAGTGGTCTCAGGTCTCATGAGCACCATCTCAGCAATCTCTCCAGCCTTGAGGCTGGCCAGGAAAGCCTCAACCGTCATTTCAT
CGAGGTTCAGTATCTCTGCAACCTCTGGCAACGGCTCCAAGTGGACACCAGATGCCTTGATGGGTCAACCGGTCTCGCCATCGAAGATGTGATAACACTC
TTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATTTCAGATCCGACTTGAGGCGGCGGCGGCGTCGTTGAC
GACGGCGACCGTGATGTGGAGCTTTGCTGCTTACGTCTAGGGATGTCGGCGCTGTGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTGGTACCCAC
ACAGGAAGCGTGTTCGACGCCTTCCTCTTCAGCTAAGGTCTGGGCGACCGTAAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCGTG
ACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCTTGTGAACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGCGCTGCCACCATCAAAACATTCT
CGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCGGATGCTTTGGTACCCTGGCAGCCCTTGCGGGAGCCCCGGGTCCTGACAGAGTTGGGAACA
TGACTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGGCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATCA
CGAAGACTTAGTTCTTCCCCAGTAAGGAGCCCCGCCCCTACTGGCTTCCGGCGTTTTCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTAGAAGAC
GGGCTTGGGAAAAGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGGAGTGGACCATCTTCCCGCAGCCGAAGCAGCGGATGTCACGCTGTTCG
GCGGACCCGAGCTCCATGGGGACTGGTCCGCTGGTGCTTGGTCGACCGGGGGTCAGACATGGAACTCCCAGAACACGCTGAGGCCCGGTACCGCCAACTG
GTGATGGCTGTACTCTTCCTGAAGGGTCACTTGAA