Description :
From Genome Similarity Track
Location :
Scaffold_1046:325- 1678
Transcript NameFunction/comments
Physo_145326retrotransposon protein, putative, Ty1-copia subclass

Sequence
1353 bases(100 bases per row)
AAGAACGAGACGTGGACCCTGGTGCCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTCCGCGTGAAGGAGAACCAGTCTGGAGAGATCG
AGCGGTTCAAGGCGCGACTGGTGGCGAAGGGGTTCTCCCAGAAGTACGGCATCGACTACGACGAGACGTTCGCGCCGGTGGCCAAGTTCACGTCGATTCG
GGTGTTGCTGAGTCTGGCGGCCAAGTACAAGCTCACAGTGCACCAGATGGATGTGAAGACCGCGTTCCTCAACGGCTTGTTGGATGAGGACATCTACATG
GCGCAGCCGGACGGATATGTGGACGGAGATCGACCCGACTACGTGTGCCGGCTCAAGCGTTCGCTGTACGGCCTGAAGCAGTCGCCGCGGATGTGGAACA
AGACGATCGACGAGTTCATGTTGAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCATCTACTTGAAGCGGGACAATCACGACATGATGTTCGTGGC
ACTGTACGTGGACGATCTGGTACTCGCCAGCAGCAGCGACGGGATGCTGAAGGACACGAAGCAGGCGCTGAGTGACCGGTTCGAGATGACTGACATGGGC
CAGCTCAAGTACTTCCTCGGTATGGAGATCGAGCAAGATGTGGCGACTGGGAAGGTGTCGGTGCGGCAGACCAAGTTCGCGAAGGACATTCTCGAGAAGT
TCAAGATGGATGAGAGCAACCCTGTGAAGACACCGCAGGATCCGGGTCTGAAGCTGACCAAGGCCATGTGCGAGGGAGGCTGCAAGCACGACGAGACCAT
GGCGAATGTTCCGTACCGGAACGCCGTGGGCTGCCTCATGTATCTCATGGTGGGGACTCGTCCGGACCTCGCAGCGGCAGTGGGAGTACTGAGCCAGTTC
GCAGCGGACCCATGTCCGACACACTGGCAGGCGCTCAAGAGGGTCTTCCGCTACATCCGAGGCACGAAGACGCACGGCCTCGTGTTTCAAGCGAGCAGCG
AGGACGGACTGCAAGGCTACTCGGACGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGTACGAGCGGCTACGCGTTCATGGTGAACGGCGGATGCAT
CAGCTGGCGAAGCAAGAAGCAGCGCACGGTGGCGCTCTCGTCGACGGAAGCCGAGTACATGGCGCTGTCGGAGGCCACGCAGGAGGCGGTGTGGCTCAAG
GTGTTTCTGTGCGAGCTGGGCGAGATGGCGAGCGATGAAGCGGTGAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGGAGTTCC
ACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTG