Description :
From Genome Similarity Track
Location :
Scaffold_2030:325- 1642
Transcript NameFunction/comments
Phypl_g14573conserved hypothetical protein

Sequence
1317 bases(100 bases per row)
TCAGTGatattatcactactaatcTTGAAGAACCTCAACCCACCTTGGATCATGAAAGGCCGCGCGCAATTGGTGGGTTTCCCGCCTTCTCCCTCCCCGC
CCCCCTCCTGTTCGCTCATTCTTCGACTTACGACGCTGGATTCACTACCAATGAAGTGTGGTAAGATTGACTGTTGCTGGGGAGACGTACCGGCGACGTC
TCCTTGCAGTGTTTGTGGGCTTCTAGTGCATCATctgtgcagcaacgagctgtgcACCACTGCAGAACTGTCTAAAAGGTGACGCGGTCGATAGTAACAT
GCTGTTTATGCTTCACAGTCGAGCTAACATGATGAACACGCAGGTTTTGCAGTCGCGAGTGTGTGAACAAGTTCTTTCACCCCGATAGTGACTCTCAGGA
GCTTACACCAAGCAGCCACTCGGGAATATCAGTGTCGAGCCAGGCTTCTGTGATAGACCTAGCACAGGAGGAGTTGGAGCATGAGCAAGAAACGACGAAC
AGTATTCCTGACGAAATCAGCCACGCCCCCAAAGCGAACACGACGGACGGCGTTTGGCAATTGATACACCAACTCGGAGCACCTGTTCGGCATAACGGCA
AGCAATTCACTCACATCTGCTTGCTTTgcttgaagtcgaagtcgaagtcaTGGAAAGAGTCGCTCTGCAAGACCAGCAACTCGACCAACGCAAAGACGCA
CTTGATATCTGCCCACAAAGACCATGATATGGCTGTCAAGGAACAAAAGCATCGGATGAAACGGGCGGATCGCTACACTGTGACCGTGCCTGCTAGTACA
GGTGCGAAGTGCCAAGACCTTAACGAGCCAAGTACACAACCTGCCAAACGTAAAAAAAACCTGGTGGAAGTCGCAAGTCAGTCAGGTTCAGATAACGGGT
CACATTGCTCGTTGGCTGATTCGCGATGGTGAGTGTCATTCTATGCAGTATCCTACCGGTGGTGATAGATTGACCGAGTTGTTATGTGCCTAGGTTTGCC
CTATAACCTTGTTGCGACACCAGCATTtcgtgatcttcttgtcggtcTTACTGGAGACAAAAATGCTACTATTCCGTCCAGCAAGACGTACAATGATATT
CTAGACAATCAATATGAGACGTATGAGAAGGACGCAGCGGAGTGGTTTGCCGAGGAGtacaaggagctgcacaGCACCCCATTCATGACTGTGGAGCACG
ATCTCTGGACAAACAGCGCGAAAAATTGCATTGTGAGTGCGTCGAGTGGATTCATTGACAGAGATTGGCAGCCACGGCATCTAGCACTCCTAGCTGAAAC
TAAAAATGACGGGCATG